animal cloning essay introduction

• Essay Samples
• College Essay
• Writing Tools
• Writing guide

↑ Return to College Essay

Essay: An Introduction to Cloning

The National Human Genome Research Institute describes cloning as, “processes that can be used to produce genetically identical copies of a biological entity.” The result is called a clone and the practice of cloning living things has raised a lot of controversy over the years. In the lab, scientists have successfully cloned cells, genes and even a sheep. But is it a good idea?

Natural Cloning

Cloning occurs naturally in some cases. That includes living organisms, such as bacteria, that split and clone on their own. Cloning also occurs in organisms that reproduce using asexual reproduction. Identical twins are also considered clones, as the original cell “copies” itself and produces another human being or animal.

Artificial Cloning

Artificial cloning can be done using one of three processes – therapeutic cloning, gene cloning or reproductive cloning. Therapeutic cloning involves creating new tissue to replace injured or dead tissue. Gene cloning creates new copies of specific genes or segments of DNA. Reproductive cloning is when an entire organism is cloned, and is also what most people think of when they hear about cloning.

How is Cloning Done?

Artificial cloning is done by scientists and involves taking a gene from one organism and inserting it into the genetic material of another carrier organism. The combination of material is then placed in a safe area and allowed to clone, which occurs as the materials copy themselves over and over again.

In the case of reproductive cloning, when an entire animal is cloned, the process is a bit different. First, scientists remove a somatic cell from the original animal. This often comes from the animal’s skin. The DNA from that cell is transferred to an egg cell that has had its DNA material taken out. The egg is then able to become an embryo that is later implanted into the womb of an adult female animal. The female then gives birth to the clone. The most famous instance of this type of cloning was Dolly the sheep. Human Cloning

Despite what people have heard, human cloning is not something that is even close to happening. There is no evidence that any scientist or research facility has ever successfully cloned a human being. While there are some groups claiming to have cloned a human, the clone never reached the birthing stage. According to experts, it would be nearly impossible to clone a human as one of the proteins needed for the process is too close to a human cell’s chromosomes and removing the DNA without also damaging those proteins is very difficult to do.

Benefits of Cloning

It might sound like something out of a science fiction movie, but there are scientific benefits to cloning certain animals. By doing so, researchers are able to learn more about the animal, which can be beneficial to agriculture. When the FDA approved cloned material for human consumption, entities that raise animals for meat or milk were able to begin producing on the best meat and milk, though doing so costs more, which means that consumers would have to pay more.

Another possible benefit to cloning is to rebuild endangered species before they become extinct. By cloning these animals, their numbers could be increased, something that ensures that the stability of an ecosystem isn’t compromised. People across the world have also driven research into cloning beloved pets.

Drawbacks of Cloning

One of the biggest problems with cloning is that the clone isn’t always healthy enough to live and using clones to rebuild a species results in a lack of the variability needed for a species’s survival. Cloning adult animals means that the clone is born with “older” DNA, which shortens its lifespan.

Cloning continues to be a hot topic that is debated all over the world. What side are you on?

Follow Us on Social Media

Get more free essays

Send via email

Most useful resources for students:.

• Free Essays Download
• Writing Tools List
• Proofreading Services
• Universities Rating

Contributors Bio

Find more useful services for students

Free plagiarism check, professional editing, online tutoring, free grammar check.

ENCYCLOPEDIC ENTRY

Cloning is a technique scientists use to create exact genetic replicas of genes, cells, or animals.

Biology, Genetics, Health, Chemistry

Cloned Beagles

Two Beagle puppies successfully cloned in Seoul, South Korea. These two dogs were cloned by a biopharmaceutical company that specializes in stem cell based therapeutics.

Photograph by Handout

Cloning is a technique scientists use to make exact genetic copies of living things. Genes , cells, tissues, and even whole animals can all be cloned .

Some clones already exist in nature. Single-celled organisms like bacteria make exact copies of themselves each time they reproduce. In humans, identical twins are similar to clones . They share almost the exact same genes . Identical twins are created when a fertilized egg splits in two.

Scientists also make clones in the lab. They often clone genes in order to study and better understand them. To clone a gene , researchers take DNA from a living creature and insert it into a carrier like bacteria or yeast. Every time that carrier reproduces, a new copy of the gene is made.

Animals are cloned in one of two ways. The first is called embryo twinning. Scientists first split an embryo in half. Those two halves are then placed in a mother’s uterus. Each part of the embryo develops into a unique animal, and the two animals share the same genes . The second method is called somatic cell nuclear transfer. Somatic cells are all the cells that make up an organism, but that are not sperm or egg cells. Sperm and egg cells contain only one set of chromosomes , and when they join during fertilization, the mother’s chromosomes merge with the father’s. Somatic cells , on the other hand, already contain two full sets of chromosomes . To make a clone , scientists transfer the DNA from an animal’s somatic cell into an egg cell that has had its nucleus and DNA removed. The egg develops into an embryo that contains the same genes as the cell donor. Then the embryo is implanted into an adult female’s uterus to grow.

In 1996, Scottish scientists cloned the first animal, a sheep they named Dolly. She was cloned using an udder cell taken from an adult sheep. Since then, scientists have cloned cows, cats, deer, horses, and rabbits. They still have not cloned a human, though. In part, this is because it is difficult to produce a viable clone . In each attempt, there can be genetic mistakes that prevent the clone from surviving. It took scientists 276 attempts to get Dolly right. There are also ethical concerns about cloning a human being.

Researchers can use clones in many ways. An embryo made by cloning can be turned into a stem cell factory. Stem cells are an early form of cells that can grow into many different types of cells and tissues. Scientists can turn them into nerve cells to fix a damaged spinal cord or insulin-making cells to treat diabetes.

The cloning of animals has been used in a number of different applications. Animals have been cloned to have gene mutations that help scientists study diseases that develop in the animals. Livestock like cows and pigs have been cloned to produce more milk or meat. Clones can even “resurrect” a beloved pet that has died. In 2001, a cat named CC was the first pet to be created through cloning. Cloning might one day bring back extinct species like the woolly mammoth or giant panda.

Media Credits

The audio, illustrations, photos, and videos are credited beneath the media asset, except for promotional images, which generally link to another page that contains the media credit. The Rights Holder for media is the person or group credited.

Production Managers

Program specialists, specialist, content production, last updated.

October 19, 2023

User Permissions

For information on user permissions, please read our Terms of Service. If you have questions about how to cite anything on our website in your project or classroom presentation, please contact your teacher. They will best know the preferred format. When you reach out to them, you will need the page title, URL, and the date you accessed the resource.

If a media asset is downloadable, a download button appears in the corner of the media viewer. If no button appears, you cannot download or save the media.

Text on this page is printable and can be used according to our Terms of Service .

Interactives

Any interactives on this page can only be played while you are visiting our website. You cannot download interactives.

Related Resources

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

The PMC website is updating on October 15, 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• v.52(5); 2011 May

Genetic engineering of animals: Ethical issues, including welfare concerns

The genetic engineering of animals has increased significantly in recent years, and the use of this technology brings with it ethical issues, some of which relate to animal welfare — defined by the World Organisation for Animal Health as “the state of the animal…how an animal is coping with the conditions in which it lives” ( 1 ). These issues need to be considered by all stakeholders, including veterinarians, to ensure that all parties are aware of the ethical issues at stake and can make a valid contribution to the current debate regarding the creation and use of genetically engineered animals. In addition, it is important to try to reflect societal values within scientific practice and emerging technology, especially publicly funded efforts that aim to provide societal benefits, but that may be deemed ethically contentious. As a result of the extra challenges that genetically engineered animals bring, governing bodies have started to develop relevant policies, often calling for increased vigilance and monitoring of potential animal welfare impacts ( 2 ). Veterinarians can play an important role in carrying out such monitoring, especially in the research setting when new genetically engineered animal strains are being developed.

Several terms are used to describe genetically engineered animals: genetically modified, genetically altered, genetically manipulated, transgenic, and biotechnology-derived, amongst others. In the early stages of genetic engineering, the primary technology used was transgenesis, literally meaning the transfer of genetic material from one organism to another. However, with advances in the field, new technology emerged that did not necessarily require transgenesis: recent applications allow for the creation of genetically engineered animals via the deletion of genes, or the manipulation of genes already present. To reflect this progress and to include those animals that are not strictly transgenic, the umbrella term “genetically engineered” has been adopted into the guidelines developed by the Canadian Council on Animal Care (CCAC). For clarity, in the new CCAC guidelines on: genetically-engineered animals used in science (currently in preparation) the CCAC offers the following definition of a genetically engineered animal: “an animal that has had a change in its nuclear or mitochondrial DNA (addition, deletion, or substitution of some part of the animal’s genetic material or insertion of foreign DNA) achieved through a deliberate human technological intervention.” Those animals that have undergone induced mutations (for example, by chemicals or radiation — as distinct from spontaneous mutations that naturally occur in populations) and cloned animals are also considered to be genetically engineered due to the direct intervention and planning involved in creation of these animals.

Cloning is the replication of certain cell types from a “parent” cell, or the replication of a certain part of the cell or DNA to propagate a particular desirable genetic trait. There are 3 types of cloning: DNA cloning, therapeutic cloning, and reproductive cloning ( 3 ). For the purposes of this paper, the term “cloning” is used to refer to reproductive cloning, as this is the most likely to lead to animal welfare issues. Reproductive cloning is used if the intention is to generate an animal that has the same nuclear DNA as another currently, or previously existing animal. The process used to generate this type of cloned animal is called somatic cell nuclear transfer (SCNT) ( 4 ).

During the development of the CCAC guidelines on: genetically- engineered animals used in science, some key ethical issues, including animal welfare concerns, were identified: 1) invasiveness of procedures; 2) large numbers of animals required; 3) unanticipated welfare concerns; and 4) how to establish ethical limits to genetic engineering (see Ethical issues of genetic engineering). The different applications of genetically engineered animals are presented first to provide context for the discussion.

Current context of genetically engineered animals

Genetic engineering technology has numerous applications involving companion, wild, and farm animals, and animal models used in scientific research. The majority of genetically engineered animals are still in the research phase, rather than actually in use for their intended applications, or commercially available.

Companion animals

By inserting genes from sea anemone and jellyfish, zebrafish have been genetically engineered to express fluorescent proteins — hence the commonly termed “GloFish.” GloFish began to be marketed in the United States in 2003 as ornamental pet fish; however, their sale sparked controversial ethical debates in California — the only US state to prohibit the sale of GloFish as pets ( 5 ). In addition to the insertion of foreign genes, gene knock-out techniques are also being used to create designer companion animals. For example, in the creation of hypoallergenic cats some companies use genetic engineering techniques to remove the gene that codes for the major cat allergen Fel d1: ( http://www.felixpets.com/technology.html ).

Companion species have also been derived by cloning. The first cloned cat, “CC,” was created in 2002 ( 6 ). At the time, the ability to clone mammals was a coveted prize, and after just a few years scientists created the first cloned dog, “Snuppy” ( 7 ).

With the exception of a couple of isolated cases, the genetically engineered pet industry is yet to move forward. However, it remains feasible that genetically engineered pets could become part of day-to-day life for practicing veterinarians, and there is evidence that clients have started to enquire about genetic engineering services, in particular the cloning of deceased pets ( 5 ).

Wild animals

The primary application of genetic engineering to wild species involves cloning. This technology could be applied to either extinct or endangered species; for example, there have been plans to clone the extinct thylacine and the woolly mammoth ( 5 ). Holt et al ( 8 ) point out that, “As many conservationists are still suspicious of reproductive technologies, it is unlikely that cloning techniques would be easily accepted. Individuals involved in field conservation often harbour suspicions that hi-tech approaches, backed by high profile publicity would divert funding away from their own efforts.” However, cloning may prove to be an important tool to be used alongside other forms of assisted reproduction to help retain genetic diversity in small populations of endangered species.

Farm animals

As reviewed by Laible ( 9 ), there is “an assorted range of agricultural livestock applications [for genetic engineering] aimed at improving animal productivity; food quality and disease resistance; and environmental sustainability.” Productivity of farm animal species can be increased using genetic engineering. Examples include transgenic pigs and sheep that have been genetically altered to express higher levels of growth hormone ( 9 ).

Genetically engineered farm animals can be created to enhance food quality ( 9 ). For example, pigs have been genetically engineered to express the Δ12 fatty acid desaturase gene (from spinach) for higher levels of omega-3, and goats have been genetically engineered to express human lysozyme in their milk. Such advances may add to the nutritional value of animal-based products.

Farm species may be genetically engineered to create disease-resistant animals ( 9 ). Specific examples include conferring immunity to offspring via antibody expression in the milk of the mother; disruption of the virus entry mechanism (which is applicable to diseases such as pseudorabies); resistance to prion diseases; parasite control (especially in sheep); and mastitis resistance (particularly in cattle).

Genetic engineering has also been applied with the aim of reducing agricultural pollution. The best-known example is the Enviropig TM ; a pig that is genetically engineered to produce an enzyme that breaks down dietary phosphorus (phytase), thus limiting the amount of phosphorus released in its manure ( 9 ).

Despite resistance to the commercialization of genetically engineered animals for food production, primarily due to lack of support from the public ( 10 ), a recent debate over genetically engineered AquAdvantage TM Atlantic salmon may result in these animals being introduced into commercial production ( 11 ).

Effort has also been made to generate genetically engineered farm species such as cows, goats, and sheep that express medically important proteins in their milk. According to Dyck et al ( 12 ), “transgenic animal bioreactors represent a powerful tool to address the growing need for therapeutic recombinant proteins.” In 2006, ATryn ® became the first therapeutic protein produced by genetically engineered animals to be approved by the Food and Drug Administration (FDA) of the United States. This product is used as a prophylactic treatment for patients that have hereditary antithrombin deficiency and are undergoing surgical procedures.

Research animals

Biomedical applications of genetically engineered animals are numerous, and include understanding of gene function, modeling of human disease to either understand disease mechanisms or to aid drug development, and xenotransplantation.

Through the addition, removal, or alteration of genes, scientists can pinpoint what a gene does by observing the biological systems that are affected. While some genetic alterations have no obvious effect, others may produce different phenotypes that can be used by researchers to understand the function of the affected genes. Genetic engineering has enabled the creation of human disease models that were previously unavailable. Animal models of human disease are valuable resources for understanding how and why a particular disease develops, and what can be done to halt or reverse the process. As a result, efforts have focused on developing new genetically engineered animal models of conditions such as Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), Parkinson’s disease, and cancer. However, as Wells ( 13 ) points out: “these [genetically engineered animal] models do not always accurately reflect the human condition, and care must be taken to understand the limitation of such models.”

The use of genetically engineered animals has also become routine within the pharmaceutical industry, for drug discovery, drug development, and risk assessment. As discussed by Rudmann and Durham ( 14 ): “Transgenic and knock out mouse models are extremely useful in drug discovery, especially when defining potential therapeutic targets for modifying immune and inflammatory responses…Specific areas for which [genetically engineered animal models] may be useful are in screening for drug induced immunotoxicity, genotoxicity, and carcinogenicity, and in understanding toxicity related drug metabolizing enzyme systems.”

Perhaps the most controversial use of genetically engineered animals in science is to develop the basic research on xenotrans-plantation — that is, the transplant of cells, tissues, or whole organs from animal donors into human recipients. In relation to organ transplants, scientists have developed a genetically engineered pig with the aim of reducing rejection of pig organs by human recipients ( 15 ). This particular application of genetic engineering is currently at the basic research stage, but it shows great promise in alleviating the long waiting lists for organ transplants, as the number of people needing transplants currently far outweighs the number of donated organs. However, as a direct result of public consultation, a moratorium is currently in place preventing pig organ transplantation from entering a clinical trial phase until the public is assured that the potential disease transfer from pigs to humans can be satisfactorily managed ( 16 ). According to Health Canada, “xenotransplantation is currently not prohibited in Canada. However, the live cells and organs from animal sources are considered to be therapeutic products (drugs or medical devices)…No clinical trial involving xenotransplantation has yet been approved by Health Canada” (see http://www.hc-sc.gc.ca for details).

Ethical issues of genetic engineering

Ethical issues, including concerns for animal welfare, can arise at all stages in the generation and life span of an individual genetically engineered animal. The following sections detail some of the issues that have arisen during the peer-driven guidelines development process and associated impact analysis consultations carried out by the CCAC. The CCAC works to an accepted ethic of animal use in science, which includes the principles of the Three Rs (Reduction of animal numbers, Refinement of practices and husbandry to minimize pain and distress, and Replacement of animals with non-animal alternatives wherever possible) ( 17 ). Together the Three Rs aim to minimize any pain and distress experienced by the animals used, and as such, they are considered the principles of humane experimental technique. However, despite the steps taken to minimize pain and distress, there is evidence of public concerns that go beyond the Three Rs and animal welfare regarding the creation and use of genetically engineered animals ( 18 ).

Concerns for animal welfare

Invasiveness of procedures.

The generation of a new genetically engineered line of animals often involves the sacrifice of some animals and surgical procedures (for example, vasectomy, surgical embryo transfer) on others. These procedures are not unique to genetically engineered animals, but they are typically required for their production.

During the creation of new genetically engineered animals (particularly mammalian species) oocyte and blastocyst donor females may be induced to superovulate via intraperitoneal or subcutaneous injection of hormones; genetically engineered embryos may be surgically implanted to female recipients; males may be surgically vasectomized under general anesthesia and then used to induce pseudopregnancy in female embryo recipients; and all offspring need to be genotyped, which is typically performed by taking tissue samples, sometimes using tail biopsies or ear notching ( 19 ). However, progress is being made to refine the genetic engineering techniques that are applied to mammals (mice in particular) so that less invasive methods are feasible. For example, typical genetic engineering procedures require surgery on the recipient female so that genetically engineered embryos can be implanted and can grow to full term; however, a technique called non-surgical embryo transfer (NSET) acts in a similar way to artificial insemination, and removes the need for invasive surgery ( 20 ). Other refinements include a method referred to as “deathless transgenesis,” which involves the introduction of DNA into the sperm cells of live males and removes the need to euthanize females in order to obtain germ line transmission of a genetic alteration; and the use of polymerase chain reaction (PCR) for genotyping, which requires less tissue than Southern Blot Analysis ( 20 ).

Large numbers of animals required

Many of the embryos that undergo genetic engineering procedures do not survive, and of those that do survive only a small proportion (between 1% to 30%) carry the genetic alteration of interest ( 19 ). This means that large numbers of animals are produced to obtain genetically engineered animals that are of scientific value, and this contradicts efforts to minimize animal use. In addition, the advancement of genetic engineering technologies in recent years has lead to a rapid increase in the number and varieties of genetically engineered animals, particularly mice ( 21 ). Although the technology is continually being refined, current genetic engineering techniques remain relatively inefficient, with many surplus animals being exposed to harmful procedures. One key refinement and reduction effort is the preservation of genetically engineered animal lines through the freezing of embryos or sperm (cryopreservation), which is particularly important for those lines with the potential to experience pain and distress ( 22 ).

As mentioned, the number of research projects creating and/or using genetically engineered animals worldwide has increased in the past decade ( 21 ). In Canada, the CCAC’s annual data on the numbers of animals used in science show an increase in Category D procedures (procedures with the potential to cause moderate to severe pain and distress) — at present the creation of a new genetically engineered animal line is a Category D procedure ( 23 ). The data also show an increase in the use of mice ( 24 ), which are currently the most commonly used species for genetic engineering, making up over 90% of the genetically engineered animals used in research and testing ( 21 ). This rise in animal use challenges the Three Rs principle of Reduction ( 17 ). It has been reasoned that once created, the use of genetically engineered animals will reduce the total number of animals used in any given experiment by providing novel and more accurate animal models, especially in applications such as toxicity testing ( 25 ). However, the greater variety of available applications, and the large numbers of animals required for the creation and maintenance of new genetically engineered strains indicate that there is still progress to be made in implementation of the Three Rs principle of Reduction in relation to the creation and use of genetically engineered animals ( 21 ).

Unanticipated welfare concerns

Little data has been collected on the net welfare impacts to genetically engineered animals or to those animals required for their creation, and genetic engineering techniques have been described as both unpredictable and inefficient ( 19 ). The latter is due, in part, to the limitations in controlling the integration site of foreign DNA, which is inherent in some genetic engineering techniques (such as pro-nuclear microinjection). In such cases, scientists may generate several independent lines of genetically engineered animals that differ only in the integration site ( 26 ), thereby further increasing the numbers of animals involved. This conflicts with efforts to adhere to the principles of the Three Rs, specifically Reduction. With other, more refined techniques that allow greater control of DNA integration (for example, gene targeting), unexpected outcomes are attributed to the unpredictable interaction of the introduced DNA with host genes. These interactions also vary with the genetic background of the animal, as has frequently been observed in genetically engineered mice ( 27 ). Interfering with the genome by inserting or removing fragments of DNA may result in alteration of the animal’s normal genetic homeostasis, which can be manifested in the behavior and well-being of the animals in unpredictable ways. For example, many of the early transgenic livestock studies produced animals with a range of unexpected side effects including lameness, susceptibility to stress, and reduced fertility ( 9 ).

A significant limitation of current cloning technology is the prospect that cloned offspring may suffer some degree of abnormality. Studies have revealed that cloned mammals may suffer from developmental abnormalities, including extended gestation; large birth weight; inadequate placental formation; and histological effects in organs and tissues (for example, kidneys, brain, cardiovascular system, and muscle). One annotated review highlights 11 different original research articles that documented the production of cloned animals with abnormalities occurring in the developing embryo, and suffering for the newborn animal and the surrogate mother ( 28 ).

Genetically engineered animals, even those with the same gene manipulation, can exhibit a variety of phenotypes; some causing no welfare issues, and some causing negative welfare impacts. It is often difficult to predict the effects a particular genetic modification can have on an individual animal, so genetically engineered animals must be monitored closely to mitigate any unanticipated welfare concerns as they arise. For newly created genetically engineered animals, the level of monitoring needs to be greater than that for regular animals due to the lack of predictability. Once a genetically engineered animal line is established and the welfare concerns are known, it may be possible to reduce the levels of monitoring if the animals are not exhibiting a phenotype that has negative welfare impacts. To aid this monitoring process, some authors have called for the implementation of a genetically engineered animal passport that accompanies an individual animal and alerts animal care staff to the particular welfare needs of that animal ( 29 ). This passport document is also important if the intention is to breed from the genetically engineered animal in question, so the appropriate care and husbandry can be in place for the offspring.

With progress in genetic engineering techniques, new methods ( 30 , 31 ) may substantially reduce the unpredictability of the location of gene insertion. As a result, genetic engineering procedures may become less of a welfare concern over time.

Beyond animal welfare

As pointed out by Lassen et al ( 32 ), “Until recently the main limits [to genetic engineering] were technical: what it is possible to do. Now scientists are faced with ethical limits as well: what it is acceptable to do” (emphasis theirs). Questions regarding whether it is acceptable to make new transgenic animals go beyond consideration of the Three Rs, animal health, and animal welfare, and prompt the discussion of concepts such as intrinsic value, integrity, and naturalness ( 33 ).

When discussing the “nature” of an animal, it may be useful to consider the Aristotelian concept of telos, which describes the “essence and purpose of a creature” ( 34 ). Philosopher Bernard Rollin applied this concept to animal ethics as follows: “Though [ telos ] is partially metaphysical (in defining a way of looking at the world), and partially empirical (in that it can and will be deepened and refined by increasing empirical knowledge), it is at root a moral notion, both because it is morally motivated and because it contains the notion of what about an animal we ought to at least try to respect and accommodate” (emphasis Rollin’s) ( 34 ). Rollin has also argued that as long as we are careful to accommodate the animal’s interests when we alter an animal’s telos, it is morally permissible. He writes, “…given a telos, we should respect the interests which flow from it. This principle does not logically entail that we cannot modify the telos and thereby generate different or alternative interests” ( 34 ).

Views such as those put forward by Rollin have been argued against on the grounds that health and welfare (or animal interests) may not be the only things to consider when establishing ethical limits. Some authors have made the case that genetic engineering requires us to expand our existing notions of animal ethics to include concepts of the intrinsic value of animals ( 35 ), or of animal “integrity” or “dignity” ( 33 ). Veerhoog argues that, “we misuse the word telos when we say that human beings can ‘change’ the telos of an animal or create a new telos ” — that is to say animals have intrinsic value, which is separate from their value to humans. It is often on these grounds that people will argue that genetic engineering of animals is morally wrong. For example, in a case study of public opinion on issues related to genetic engineering, participants raised concerns about the “nature” of animals and how this is affected (negatively) by genetic engineering ( 18 ).

An alternative view put forward by Schicktanz ( 36 ) argues that it is the human-animal relationship that may be damaged by genetic engineering due to the increasingly imbalanced distribution of power between humans and animals. This imbalance is termed “asymmetry” and it is raised alongside “ambivalence” as a concern regarding modern human-animal relationships. By using genetically engineered animals as a case study, Schicktanz ( 36 ) argues that genetic engineering presents “a troubling shift for all human-animal relationships.”

Opinions regarding whether limits can, or should, be placed on genetic engineering are often dependent on people’s broader worldview. For some, the genetic engineering of animals may not put their moral principles at risk. For example, this could perhaps be because genetic engineering is seen as a logical continuation of selective breeding, a practice that humans have been carrying out for years; or because human life is deemed more important than animal life. So if genetic engineering creates animals that help us to develop new human medicine then, ethically speaking, we may actually have a moral obligation to create and use them; or because of an expectation that genetic engineering of animals can help reduce experimental animal numbers, thus implementing the accepted Three Rs framework.

For others, the genetic engineering of animals may put their moral principles at risk. For example costs may always be seen to outweigh benefits because the ultimate cost is the violation of species integrity and disregard for the inherent value of animals. Some may view telos as something that cannot or should not be altered, and therefore altering the telos of an animal would be morally wrong. Some may see genetic engineering as exaggerating the imbalance of power between humans and animals, whilst others may fear that the release of genetically engineered animals will upset the natural balance of the ecosystem. In addition, there may be those who feel strongly opposed to certain applications of genetic engineering, but more accepting of others. For example, recent evidence suggests that people may be more accepting of biomedical applications than those relating to food production ( 37 ).

Such underlying complexity of views regarding genetic engineering makes the setting of ethical limits difficult to achieve, or indeed, even discuss. However, progress needs to be made on this important issue, especially for those genetically engineered species that are intended for life outside the research laboratory, where there may be less careful oversight of animal welfare. Consequently, limits to genetic engineering need to be established using the full breadth of public and expert opinion. This highlights the importance for veterinarians, as animal health experts, to be involved in the discussion.

Other ethical issues

Genetic engineering also brings with it concerns over intellectual property, and patenting of created animals and/or the techniques used to create them. Preserving intellectual property can breed a culture of confidentiality within the scientific community, which in turn limits data and animal sharing. Such limits to data and animal sharing may create situations in which there is unnecessary duplication of genetically engineered animal lines, thereby challenging the principle of Reduction. Indeed, this was a concern that was identified in a recent workshop on the creation and use of genetically engineered animals in science ( 20 ).

It should be noted that no matter what the application of genetically engineered animals, there are restrictions on the methods of their disposal once they have been euthanized. The reason for this is to restrict the entry of genetically engineered animal carcasses into the natural ecosystem until the long-term effects and risks are better understood. Environment Canada ( http://www.ec.gc.ca/ ) and Health Canada ( http://www.hc-sc.gc.ca/ ) offer specific guidelines in this regard.

Implications for veterinarians

As genetically engineered animals begin to enter the commercial realm, it will become increasingly important for veterinarians to inform themselves about any special care and management required by these animals. As animal health professionals, veterinarians can also make important contributions to policy discussions related to the oversight of genetic engineering as it is applied to animals, and to regulatory proceedings for the commercial use of genetically engineered animals.

It is likely that public acceptance of genetically engineered animal products will be an important step in determining when and what types of genetically engineered animals will appear on the commercial market, especially those animals used for food production. Veterinarians may also be called on to inform the public about genetic engineering techniques and any potential impacts to animal welfare and food safety. Consequently, for the discussion regarding genetically engineered animals to progress effectively, veterinarians need to be aware of the current context in which genetically engineered animals are created and used, and to be aware of the manner in which genetic engineering technology and the animals derived from it may be used in the future.

Genetic engineering techniques can be applied to a range of animal species, and although many genetically engineered animals are still in the research phase, there are a variety of intended applications for their use. Although genetic engineering may provide substantial benefits in areas such as biomedical science and food production, the creation and use of genetically engineered animals not only challenge the Three Rs principles, but may also raise ethical issues that go beyond considerations of animal health, animal welfare, and the Three Rs, opening up issues relating to animal integrity and/or dignity. Consequently, even if animal welfare can be satisfactorily safeguarded, intrinsic ethical concerns about the genetic engineering of animals may be cause enough to restrict certain types of genetically engineered animals from reaching their intended commercial application. Given the complexity of views regarding genetic engineering, it is valuable to involve all stakeholders in discussions about the applications of this technology.

Acknowledgments

The authors thank the members of the Canadian Veterinary Medicine Association Animal Welfare Committee for their comments on the draft, and Dr. C. Schuppli for her insight on how the issues discussed may affect veterinarians.

Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ( gro.vmca-amvc@nothguorbh ) for additional copies or permission to use this material elsewhere.

The History of Cloning

Lost in the midst of all the buzz about cloning is the fact that cloning is nothing new: its rich scientific history spans more than 100 years. The landmark examples below will take you on a journey through time, where you can learn more about the history of cloning.

1885 - First-ever demonstration of artificial embryo twinning

Hans Adolf Eduard Driesch

The sea urchin is a relatively simple organism that is useful for studying development. Dreisch showed that by merely shaking two-celled sea urchin embryos, it was possible to separate the cells. Once separated, each cell grew into a complete sea urchin.

This experiment showed that each cell in the early embryo has its own complete set of genetic instructions and can grow into a full organism.

1902 - Artificial embryo twinning in a vertebrate

Hans Spemann

Spemann’s first challenge was to figure out how to split the two cells of an embryo much stickier than sea urchin cells. Spemann fashioned a tiny noose from a strand of baby hair and tightened it between two cells of a salamander embryo until they separated. Each cell grew into an adult salamander. Spemann also tried to divide more advanced salamander embryos using this method, but he found that cells from these embryos weren’t as successful at developing into adult salamanders.

This experiment showed that embryos from a more-complex animal can also be “twinned” to form multiple identical organisms—but only up to a certain stage in development.

1928 - The cell nucleus controls embryonic development

Again using a strand of baby hair tied into a noose, Spemann temporarily squeezed a fertilized salamander egg to push the nucleus to one side of the cytoplasm. The egg divided into cells—but only on the side with the nucleus. After four cell divisions, which made 16 cells, Spemann loosened the noose, letting the nucleus from one of the cells slide back into the non-dividing side of the egg. He used the noose to separate this “new” cell from the rest of the embryo. The single cell grew into a new salamander embryo, as did the remaining cells that were separated.

Essentially the first instance of nuclear transfer, this experiment showed that the nucleus from an early embryonic cell directs the complete growth of a salamander, effectively substituting for the nucleus in a fertilized egg.

1952 - First successful nuclear transfer

Robert Briggs and Thomas King

Briggs and King transferred the nucleus from an early tadpole embryo into an enucleated frog egg (a frog egg from which the nucleus had been removed). The resulting cell developed into a tadpole.

The scientists created many normal tadpole clones using nuclei from early embryos. But just like Spemann’s salamander experiments, cloning was less successful with donor nuclei from more advanced embryos: the few tadpole clones that did survive grew abnormally.

Most importantly, this experiment showed that nuclear transfer was a viable cloning technique. It also reinforced two earlier observations. First, the nucleus directs cell growth and, ultimately, an organism’s development. Second, embryonic cells early in development are better for cloning than cells at later stages.

1958 - Nuclear transfer from a differentiated cell

John Gurdon

Gurdon transplanted the nucleus of a tadpole intestinal cell into an enucleated frog egg. In this way, he created tadpoles that were genetically identical to the one from which the intestinal cell was taken.

This experiment showed that, despite previous failures, nuclei from somatic cells in a fully developed animal could be used for cloning. Importantly, it suggested that cells retain all of their genetic material even as they divide and differentiate (although some wondered if the donor DNA came from a stem cell, which can differentiate into multiple types of cells).

1975 - First mammalian embryo created by nuclear transfer

J. Derek Bromhall

Mammalian egg cells are much smaller than those of frogs or salamanders, so they are harder to manipulate. Using a glass pipette as a tiny straw, Bromhall transferred the nucleus from a rabbit embryo cell into an enucleated rabbit egg cell. He considered the procedure a success when a morula, or advanced embryo, developed after a couple of days.

This experiment showed that mammalian embryos could be created by nuclear transfer. To show that the embryos could continue developing, Bromhall would have had to place them into a mother rabbit's womb. He never did this experiment.

1984 - First mammal created by nuclear transfer

Steen Willadsen

Willadsen used a chemical process to separated one cell from an 8-cell lamb embryo. The he used a small electrical shock to fuse it to an enucleated egg cell. As luck would have it, the new cell started dividing.

By this time, in vitro fertilization techniques had been developed, and they had been used successfully to help couples have babies. So after a few days, Willadsen placed the lamb embryos into the womb of surrogate mother sheep. The result was the birth of three live lambs.

This experiment showed that it was possible to clone a mammal by nuclear transfer—and that the clone could fully develop. Even though the donor nuclei came from early embryonic cells, the experiment was considered a great success.

1987 - Nuclear transfer from embryonic cell

Neal First, Randal Prather, and Willard Eyestone

Using methods very similar to those used by Willadsen on sheep, First, Prather, and Eyestone produced two cloned calves. Their names were Fusion and Copy.

This experiment added cows to the list of mammals that could be cloned by nuclear transfer. Still, mammalian cloning was limited to using embryonic cells as nuclear donors. Cloning using nuclei from differentiated adult somatic cells still wasn’t thought possible.

1996 - Nuclear transfer from laboratory cells

Ian Wilmut and Keith Campbell

All previous cloning experiments used donor nuclei from cells in early embryos. In this experiment, the donor nuclei came from a slightly different source: cultured sheep cells, which were kept alive in the laboratory.

Wilmut and Campbell transferred the nuclei from cultured cells into enucleated sheep egg cells. The lambs born from this procedure were named Megan and Morag.

This experiment showed that cultured cells can supply donor nuclei for cloning by nuclear transfer. Because scientists had already learned how to transfer genes into cultured cells, this experiment showed that it might be possible to use such modified cells to create transgenic animals—such as cows that could make insulin for diabetics in their milk.

1996 - Dolly: First mammal created by somatic cell nuclear transfer

In this landmark experiment, Wilmut and Campbell created a lamb by transferring the nucleus from an adult sheep's udder cell into an enucleated egg. Never before had a mammal been cloned from an adult somatic cell. What was the big deal?

Every cell’s nucleus contains a complete set of genetic information. However, while embryonic cells are ready to activate any gene, differentiated adult cells have shut down the genes that they don't need for their specific functions. When an adult cell nucleus is used as a donor, its genetic information must be reset to an embryonic state. Often the resetting process is incomplete, and the embryos fail to develop.

Of 277 attempts, only one produced an embryo that was carried to term in a surrogate mother. This famous lamb, named Dolly, brought cloning into the limelight. Her arrival started conversations about the implications of cloning, bringing controversies over human cloning and stem cell research into the public eye.

1997 - First primate created by embryonic cell nuclear transfer

Rhesus monkey.

Li Meng, John Ely, Richard Stouffer, and Don Wolf

Primates are good models for studying human disorders. Cloning identical primates would decrease the genetic variation of research animals, and therefore the number of animals need in research studies.

Similar to previous cloning experiments, Wolf’s team of scientists fused early-stage embryonic cells with enucleated monkey egg cells using a small electrical shock. The resulting embryos were then implanted into surrogate mothers. Out of 29 cloned embryos, two monkeys were born. One was a female named Neti, and the other was a male named Ditto.

This experiment showed that primates, humans’ closest relatives, can be cloned.

1997 - Nuclear transfer from genetically engineered laboratory cells

Angelika Schnieke, Keith Campbell, Ian Wilmut

This experiment was an exciting combination of findings from earlier work. Campbell and Wilmut had already created a clone using the nucleus of a cultured cell. This time, the researchers introduced the human Factor IX (“factor nine”) gene into the genome of sheep skin cells grown in a laboratory dish. Factor IX codes for a protein that helps blood clot, and it's used to treat hemophilia, a genetic disorder where blood doesn't form proper clots.

To create the transgenic sheep, the scientists performed nuclear transfer using donor DNA from the cultured transgenic cells. The result was Polly, a sheep that produced Factor IX protein in her milk.

This experiment showed that sheep could be engineered to make therapeutic and other useful proteins in their milk, highlighting the potential medical and commercial uses for cloning.

1998-1999 - More mammals cloned by somatic cell nuclear transfer

Mice, cows, and goats.

Multiple groups

After the successes leading up to Dolly and Polly, other scientists wanted to see if similar techniques could be used to clone other mammalian species. Before long, several more animals had been successfully cloned. Among them were transgenic animals, clones made from fetal and adult cells, and a male mouse; all previous clones had been female.

2001 - Endangered animals cloned by somatic cell nuclear transfer

Gaur and mouflon.

As the list of successfully cloned animals grew, scientists began to explore cloning as a way to create animals belonging to endangered or extinct species. A challenge to cloning endangered and extinct species is finding closely related animals to serve as egg donors and surrogates. The gaur and mouflon were chosen in part because they are close relatives of domestic cattle and sheep, respectively.

In 2009, using goast as egg donors and surrogates, another group of researchers cloned the first extinct animal, a Spanish mountain goat called the bucardo. Sadly, the one kid that survived gestation died soon after birth due to a lung defect.

2007 - Primate embryonic stem cells created by somatic cell nuclear transfer

Shoukhrat Mitalipov and colleagues

Researchers took a cell from an adult monkey and fused it with an enucleated egg cell. The embryo was allowed to develop for a time, then its cells were grown in a culture dish. These cells, because they can differentiate to form any cell type, are called embryonic stem cells.

This experiment showed that nuclear transfer in a primate, which researchers had tried for years without success, was possible. It opened the door to the possibility of human therapeutic cloning: creating individual-specific stem cells that could be used to treat or study diseases.

2013 - Human embryonic stem cells created by somatic cell nuclear transfer

Overcoming decades of technical challenges, Mitalipov and colleagues were the first to use somatic cell nuclear transfer to create a human embryo that could be used as a source of embryonic stem cells. The resulting stem cell lines were specific to the patient they came from, a baby with a rare genetic disorder.

In this experiment, researchers took a skin cell from the patient and fused it with a donated egg cell. Key to the success of the experiment were modifications to the culture liquid in which the procedure was done and to the series of electrical pulses used to stimulate the egg to begin dividing.

Following the cloning controversy of 2004–2005, in which South Korean scientists falsely claimed to have used somatic cell nuclear transfer to create embryonic stem cell lines, the scientific community demanded much stronger evidence that the procedure had actually been successful.

The Pros and Cons of Animal Cloning

In 1996, a pair of scientists at the Roslin Institute at the University of Edinburgh embarked on an audacious venture. Taking the somatic cell from a 6-year-old Finn-Dorset ewe, biologists Dr. Keith Campbell and Sir Ian Wilmut inserted it in the ovum harvested from another sheep. After 276 attempts, an embryo was successfully seeded, then placed inside a third female sheep, where it underwent the gestation period typical of any normal pregnancy. 

On July 5, 1996, scientists’ bold undertaking became a roaring success when “ Dolly the Sheep ,” the first successfully cloned mammal, was born. 

Called the “ world’s most famous sheep ,” Dolly lived with her human creators at the Roslin Institute. Bred with a Welsh Mountain Ram, Dolly would produce six lambs before finally being euthanized at 6.5 years old due to progressive lung disease and severe arthritis. Dolly’s taxidermied remains are now on display at the National Museum of Scotland . 

Fast forward twenty-five years. Not wanting to be outdone by NASA’s successful landing of the Perseverance Rover on Mars , on February 18, 2021, officials with the U.S. Fish and Wildlife Service announced they had successfully cloned the first U.S. endangered species, a black-footed ferret named Elizabeth Ann. 

Looking at the photos released by Fish and Wildlife , with her adorable black eye markings resembling a robber’s mask, I had to fight the sudden urge to don a loincloth and fight an evil wizard army with Elizabeth Ann as my ever loyal side-kick, à la Beastmaster-style. However, there is one eerie difference between Elizabeth Ann the ferret and Dolly the Sheep.

Unlike Dolly, who technically had three living “mothers,” Elizabeth Ann was created using extracted cells from a black-footed ferret that had died 33 years prior. 

Born December 10, 2020, Elizabeth Ann is a genetic copy of a ferret named Willa, who died in 1988. At the time of her death, DNA technology was just in its infancy. Yet, astute (or mad) scientists froze the endangered ferret’s body, where it lay in cryogenic impassiveness, waiting until the day Willa could be “reborn.” 

Those who are already a bit squeamish with the 18 different mammal species geneticists have cloned in the past 20 years – including Mice, Pigs, Cattle, Cats, Rats, Mules, Horses, Dogs, Wolf, Water Buffalo, Goats, Camel, and even monkeys – scientist’s necromancy with Elizabeth Ann the ferret is likely pretty alarming. 

In hopes of gaining a better understanding of what feels like machiavellian-science, The Debrief takes a look at some of the pros and cons of animal cloning. 

The Pros and Cons of Animal Cloning 

It’s important to note up-front, the process of reproducing by sharing virtually identical DNA sequences does occur naturally. Living in clonal colonies, plants, fungi, and single-celled organisms, such as bacteria, have been reproducing asexually for hundreds of millions of years. 

Contrary to how it may look, recent research published in the journal of Nature Genetics shows that monozygotic or “identical” twins are not clones. After sequencing DNA from 387 pairs of identical twins, scientists found that mutations during early gestation create genetic differences in identical twins. On average, identical twins have 5.2 early genetic differences between each other. 

To examine some of the pros and cons of animal cloning, the term “cloning” here doesn’t refer to natural asexual reproduction or colloquialism. Instead, “cloning” refers to the method of artificial replication of identical cells, or DNA fragments, used to create a life that would otherwise reproduce sexually. 

Maintaining Ecological Balance and Saving Endangered Species 

Two decades ago, Yellowstone National Park was in a state of ecological crisis. 

Expansion of agriculture, the decimation of the American bison population, and government predator control programs had all but wiped out the Grey Wolf in the continental United States. With the apex predator on the brink of extinction, deer and elk populations dramatically increased, resulting in overgrazing. With deer and elk gobbling up vegetation important to soil and riverbank structure with impunity, the landscape became highly vulnerable to erosion. 

Recognizing the national park’s ecosystem’s elasticity was on the brink of collapse, in 1995, conservationists reintroduced the grey wolf   to Yellowstone, and suddenly everything changed. 

As a top predator, conservationists discovered wolves were one of the significant linchpins holding together the balance between predator and prey in Yellowstone’s ecosystem. Removal of the wolves had disrupted the food chain causing something called a  trophic cascade . 

Without facing the threat of a natural predator, deer and elk populations had multiplied to the point where they were consuming more foliage than the habitat could sustain. Consequently, the reintroduction of grey wolves to Yellowstone reduced the population numbers and changed their preys’ behavior. 

Deer and elk began avoiding the valleys and gorges at Yellowstone, where the wolves could easily hunt them. In turn, thanks to the revived food source of vegetation, these areas began to flourish with species such as birds, beavers, mice, foxes, and bears. The thriving plant life along the riverbanks caused erosion to decrease significantly.

Lessons learned from Yellowstone were that even the loss of just one species could have a cascading and catastrophic effect on an entire habitat and the environment. 

Given the devastating positive or negative effect just one species can have, consider for some, cloning is very literally the only way we might be able to save them from extinction. Take, for example, the white rhinoceros.

The world’s  last known male white rhinoceros named Sudan died  in Kenya in March of 2018. The only two confirmed white rhinos left are two females, Fau, 18, and Najin, 29, living in captivity in Kenya’s Ol Pejeta Conservancy. 

Without a male rhino to mate with, when Fau and Najin finally pass away, their entire species die with them. In hopes of preventing this demise, researchers have successfully taken frozen sperm extracted from two male rhinos after their deaths and inseminated it into eggs harvested from Fatu and Najin. As of 2020, three white rhino embryos have been generated, kept frozen until they can be placed in a surrogate female. 

As was demonstrated in the case of Dolly, cloned animals can still reproduce naturally to produce offspring. So the goal of cloning high-risk endangered species serves as an intervention. The end goal of cloning high-risk endangered species like the white rhino is to see the animals thrive and sustain themselves naturally and not be kept alive by human life-support. 

As is the case with Elizabeth Ann, cloning an endangered species could allow the animals to be reintroduced into a habitat to offset potential damage caused by their demise. With some critically endangered animals like the white rhino, cloning is simply the only method of saving species from complete extinction. 

So when it comes to the pros and cons of animal cloning, from the perspective of rescuing an entire species from extinction, it’s hard to make a case that animal cloning is a bad thing. 

Now, Elizabeth Ann’s DNA came from an animal that had been dead for over three decades, so her cloning might seem understandably creepy. However, though endangered, the black-footed ferret does indeed exist in limited populations in the wild. This brings us to the next question when examining the pros and cons of animal cloning. 

Could we resurrect a species that was already extinct, and if so, what could happen? 

Cloning Already Extinct Animals 

When it comes to the pros and cons of animal cloning, anyone who’s watched the movie franchise Jurassic Park is intimately familiar with the potential negative outcome of cloning extinct species. 

So what would happen if scientists cloned an animal that had long been extinct, like the saber-toothed tiger, woolly mammoth, or as is the case in Jurassic Park , a Velociraptor or Tyrannosaurus Rex? 

Fortunately for anyone who’s seen the habitual outcome in the movies (or unfortunately, if your thinking happens to align with the wealthy eccentric fictional character, John Hammond), resurrecting long-extinct dinosaurs is impossible. “The limit of DNA survival, which we’d need for de-extinction, is probably around one million years or less. Dinosaurs had been gone for a very long time by then,” said  Dr. Beth Shapiro, an expert in ancient DNA and biologist at the University of California. 

Even though the outcome always ends in tragedy, at least in the movies, one can’t help but feel a little let down by the news that we’ll never get a chance to see Earth’s ancient reptile rulers up close. 

Nevertheless, with dinosaurs off the table, there are still many species that have gone extinct we might be able to clone. There happens to be an entire scientific discipline called “ resurrection biology ” that examines doing just that. 

If you have not previously heard of resurrection biology, which sounds more like sorcery than science, you’re likely equally unfamiliar with the fact that scientists have already reanimated a species that had gone extinct. Albeit very briefly. 

In 2000, the Pyrenean ibex, a goat native to the Pyrenees , was declared extinct. Given that by 1913, ecologists already knew the species population had been reduced to less than 100, its loss has been called  a significant “EU conservation failure.” 

Yet, using skin cells from the last known ibex, which had died in late 1999, scientists were able to successfully make cloned embryos by inserting the ibex’s DNA into domestic goat eggs emptied of their original genetic material. 

The cloned embryos were then implanted into another subspecies of Spanish ibex or goat-ibex hybrids. Of 208 implanted embryos, seven goats became pregnant, with just one making it to term. On July 30, 2003, the  first-ever cloned extinct species  was born. 

Unfortunately, the Pyrenean ibex’s revival in the animal kingdom only lasted a few minutes. The newborn ibex had been born with an extra lobe in its left lung, causing the kid to succumb to respiratory distress syndrome and die six minutes after it was born. So far, researchers have not successfully cloned the Pyrenean ibex, and the mountain goat remains extinct. 

The difficulty in cloning a species is hardly limited to the Pyrenean ibex. With current technology, the act of shuffling DNA from one cell to another, causing developmental irregularities and abnormalities, is prevalent. 

Even when cells can be extracted and a cloned embryo successfully cultivated, scientists have to overcome another huge obstacle when working with an extinct species. There aren’t any appropriate surrogate mothers. 

Underscoring the difficulties in resurrecting an extinct species, consider with the Pyrenean ibex, researchers had the benefit of beginning their attempts almost immediately after the last goat died. Attempting to clone a species that has been gone for tens-to-hundreds-of-thousands of years is exceedingly more difficult. 

In fact, rather than using the process of somatic cell nuclear transfer – how Dolly the Sheep and Elizabeth Ann were created – to attempt the resurrection of an extinct species, scientists must engage in a process in which DNA is inserted, deleted, modified, or replaced in the genome of an organism. This technique is called genome editing or genome engineering. 

Due to  controversies surrounding the topic  and an often contentious public view , many are probably familiar with the term describing an organism’s successful genetic editing for increased food yield –  GMO (genetically modified organism) . 

To revive an animal long wiped out, resurrection biologists have to use cells from a closely related species and then modify those cells so that a living species produce offspring of an extinct species. A species that is at the forefront of de-extinction science right now is the  woolly mammoth . 

Disappearing roughly 3,700 years ago, scientists have well preserved soft tissue remains and DNA from woolly mammoths. Unfortunately, even the  most intact mammoth samples lack enough DNA to guide the production of an embryo. To overcome this, scientists have been examining using new molecular tools to edit the genomes of elephants to alter their DNA sequences to mammoth DNA. If successful, the result wouldn’t be a woolly mammoth clone, but rather a hybrid that would be mostly elephant, and a little bit mammoth. 

“If you mean 100-percent mammoth, with all mammoth genes and behaviors, that will never happen,” says Dr. Shapiro on the likelihood of ever fully cloning a woolly mammoth. 

If an extinct species can never really be restored, is there any reason for de-extinction outside of novelty? 

A June 2013 editorial by  Scientific American  criticized efforts to reanimate lost species on the basis the idea misses the mark when it comes to conservation. Editors argued that with “limited intellectual bandwidth and financial resources,” the attention-grabbing de-extinction topic diverts attention from the current biodiversity crisis. 

“A program to restore extinct species poses a risk of selling the public on a false promise that technology alone can solve our ongoing environmental woes—an implicit assurance that if a species goes away, we can snap our fingers and bring it back.” 

As far as pros and cons of animal cloning, the Scientific American editors said they stood behind efforts to prevent extinction, highlighting the black-footed ferret and white rhino as examples. 

Responding to the criticism raised by Scientific American, professor of genetics at Harvard Medical School and Director of the National Institutes of Health Center of Excellence in Genomic Science at Harvard, Dr. George Church, clapped back, suggesting the authors were the ones missing the point. 

For Dr. Church, it goes back to the grey wolves and Yellowstone National Park and the evidence of how impactful one “keystone” species can be, not just to one habitat but the entire world’s ecosystem. 

Thousands of years ago, the ice-covered tundras of Russia and Canada was home to the woolly mammoth. During that time, the area was home to a rich grass-and-ice-based ecosystems. Today, those tundras are melting, and according to Dr. Church, if this continues, it could release more greenhouse gas “than all the world’s forest would if they were burned to the ground.” 

A few genetic modifications to the modern elephant’s DNA could create a hybrid animal functionally similar to the mammoth. By reintroducing woolly mammoth hybrids to the tundras, the animals could single-handedly stave off an environmental crisis.

In an  essay published in Scientific American , Church outlines three significant ways mammoth hybrids would restore balance to the world’s coldest regions. 

• Eating dead grass, enabling the sun to reach spring grass, whose deep roots prevent erosion. 
• Increasing reflected light by felling trees, which absorb sunlight. 
• Punching through insulating snow so that freezing air penetrates the soil. 

Dr. Church provides a compelling case for why cloning for de-extinction is far from a novelty. As grey wolves demonstrated, the woolly mammoth’s return could have a significant positive impact on our planet’s ecology. However, objectively it’s essential to remember this is entirely uncharted territory for humanity, with considerable unknowns. 

Reintroducing a species that has been extinct for thousands of years could have the exact opposite effect as the grey wolf. An extinct species could easily be viewed as an invasive species by its former habitat. Instead of restoring balance, it could throw-off an ecosystem in ways we didn’t foresee. 

Given the ongoing and over a year-long struggle the world has endured with the COVID-19 pandemic, it’s also important to consider that reintroducing extinct animals could end up creating new opportunities for bacteria and viruses to develop. Even if a species was merely a hybrid, it’s hard to predict whether that might be enough to reinvigorate the conditions to foster ancient bacterial strains. Equally unknown, to what effect could archaic bacteria have on human health? 

Ultimately, there are theoretical arguments on both sides when it comes to the pros and cons of animal cloning of extinct animals. However, too many unknowns prevent us from truly knowing which side of the scale weighs the heaviest. 

Pros and Cons of Animal Cloning For Food 

Thus far, we’ve examined the pros and cons of animal cloning that can indirectly impact people’s daily lives. However, whether you realize it or not, it’s highly likely you’ve been experiencing the byproducts of animal cloning for years and didn’t even know it. 

With the breakthrough cloning of Dolly the Sheep, agricultural scientists realized cloning could duplicate prize breeding animals. Facing the potential to ensure greater yields and better meats, by the early 2000s, an entire industry surrounding the genetic modification of cows, pigs, and goats exploded on the scene. 

In truth, cloning is an expensive venture, so the overwhelming majority of livestock clones are used as breeding stock and not butchered for meat. Yet, it’s almost sure that aside from vegans, everyone has dined on beef that has come from the cloned offspring.

In 2008, the  U.S. Food and Drug Administration (FDA) declared  meat and milk from clones of cattle, swine, and goats to be “as safe to eat as food from conventionally bred animals.” Adding insult to injury for those expressing concerns, the FDA ruled that cloned food is not required to be labeled, preventing consumers’ ability to avoid meats coming from cloned animals. 

Criticizing the conclusions of the FDA’s 2008 “risk assessment,” opponents have argued cloning science is too new, not well understood, and too imprecise to adequately measure the risks. 

Pointing to their own study, the  Center for Food Safety  notes that even the FDA acknowledged in their risk assessment that “a vast quantity of animal clones are unhealthy and would not be suitable for the food supply.” 

Critics say that acknowledging the majority of cloned animals is not suitable for food supply but still approving the process for consumption; the FDA fails to address that defects in cloned animals can easily escape detection and enter human food supplies. A study performed by the National Academy of Sciences  (NAS) concluded that no method for detecting subtle health problems in clones exists. 

As the market for cloned livestock took off in the early 2000s, Sir Ian Wilmut, lead research scientist that cloned Dolly the Sheep,  expressed his reservations concerning science he helped develop being used for genetically enhanced foods. “Cattle cloners ought to be making systematic comparisons between clones and animals produced by embryo transfer, looking not just at their milk yield but also their health and lifespan,” said Wilmut. 

A 2013 study  concluded  that cloned cattle that reached adulthood and entered the food supply were essentially equivalent to conventional cattle concerning meat and milk quality. 

Consumer advocates also raise many concerns about the high doses of hormones and antibiotics used in the cloning process. Surprisingly little research has been done on the health effects of hormones used with cloned livestock, so the impact on human health isn’t entirely clear. 

Because the practice hasn’t been around long enough, the potential for adverse long-term effects from cloned food consumption is even less clear. 

Advocates of animal husbandry cloning  contend  the process allows for exact genetic copies of top breeding stock to be replicated, thereby producing healthier, superior livestock. 

Universal Translators: Going Beyond the Meaning of Words

“Cloning reproduces the healthiest animals, thus minimizing the use of antibiotics, growth hormones and other chemicals,”  reads a statement  provided by the Biotechnology Industry Organization. “Consumers can benefit from cloning because meat and milk will be more healthful, consistent, and safe.” 

Like resurrecting long-dead species, the pros and cons of animal cloning for food sources are difficult to measure. The majority of public opinion has  never polled favorably  regarding cloning and animal husbandry. However, that alone doesn’t necessitate the practice is inherently harmful. 

Ultimately, unlike de-extinction cloning, livestock’s genetic engineering is very much a significant part of the modern agricultural industry. Whether or not this is a good or bad thing is a consequence we’ll likely have to live with, no matter the outcome. 

We’ve examined the pros and cons of animal cloning and how it affects human beings and the environment. However, the most contentious slippery slope surrounding the entire topic of animal cloning is the ethical debate and the potential negative consequences on the very animal life being used. 

Ethical Pros and Cons of Animal Cloning 

Is it morally right to create a life that would not otherwise come about naturally? When it comes to the pros and cons of animal cloning, this isn’t a question that can be answered by science or ground truth. As is the case with all moral issues, the ethical terrain surrounding animal cloning is complex. 

Yet, it’s arguably the most crucial question that vexes the public and genetic scientists alike. 

For some, there exists a principled argument against humanity effectively playing God, choosing life and death over other living creatures. For others, the ethical concerns center on more nuanced yet tangible and disturbingly brazen aspects of animal cloning. 

Arguably, the most compelling moral argument is the genuine suffering often endured by the animals involved in genetic science. The pain and suffering animals experience during cloning procedures, obstetrical complications that occur with surrogate mothers, and cloned animals’ health are genuine issues. 

Success rates of cloning procedures in producing live offspring, called “efficiency” in cloning science, are pretty grim. Studies have shown the differing efficiency rates based on the somatic cell type used, ranging from 30% to 93%, of clone pregnancies resulting in miscarriages. A  separate study  found that less than 5% of cloned embryos transferred into recipient cows survive. 

When live-births occur,   research has shown mortality rates to be as high as 50%. Basically, a coin toss decides if a cloned animal ends up dying within 130 days due to chronic health issues. 

The overwhelming bulk of past research on animal cloning involves examining the efficiency rates of somatic cell transfer, which  currently shows  success rates of 5%-20% for cows and 1%-5% for other species. Little research, however, exits on the health of cloned animals into adulthood. 

A  2016 study on cloned sheep, including four from the same cell lines as Dolly, found no evidence of late-onset, non-communicable diseases. “We could find no evidence, therefore, of a detrimental long-term effect of cloning by SCNT on the health of aged offspring among our cohort,” said the study’s authors. 

In light of the researcher’s findings, the proverbial elephant in the room is that when Dolly passed away at 6.5 years old from lung disease and severe arthritis, she had only lived around half of the typical 12-year life expectancy of a Finn Dorset sheep. 

Some  speculated  Dolly could have been born with the genetic age of the cell donor used to create her, who was six at the time of cell transfer. Researchers, however,  said they found no evidence  of Dolly being born at an advanced age, and her heirs have all gone on to live long, healthy lives. 

Adding an entirely new wrinkle in the ethical pros and cons of animal cloning, in 2019, scientists at the Institute of Neuroscience (ION) in Shanghai announced they had successfully  cloned five identical macaque monkeys . As if cloning human beings’ primate cousins weren’t already concerning, Chinese scientists purposefully cloned the macaque monkeys to suffer health issues. 

To unravel the mechanisms behind complex human disorders, such as Alzheimer’s, scientists at ION used gene-editing to disable a gene crucial to the monkey’s sleep-wake cycle. “Primates are the best animal model for studying higher cognitive functions and brain disorders in humans,” said neuroscientist Mu-ming Poo, ION’s director, and co-founder. 

With their five identical cloned monkeys, researchers at ION intend to study the effects of circadian rhythm disorders in hopes of better understanding and ultimately finding cures for human beings who suffer from sleep disorders. 

Initial results of the study on circadian rhythms using the cloned monkeys were published in the journal of National Science Review – of which Mu-ming Poo is Executive Editor-in-Chief. Poo said researchers did this because “the journal needs publicity” but denied being involved in the review process. 

An animal ethics statement published with the study reads, “The use and care of cynomolgus monkeys ( M .  fascicularis ) complied with the guidelines of the Animal Advisory Committee at the Shanghai Institutes for Biological Science, Chinese Academy of Sciences.” 

In 2019, Poo  said  Chinese researchers were already planning to use cloned primates to model other brain diseases, such as Alzheimer’s disease, Parkinson’s disease, a severe genetic intellectual disability called Angelman syndrome, and several genetic eye disorders. 

A statement issued by the People for the Ethical Treatment of Animals (PETA), an animal rights group based in Norfolk, Virginia, called ION’s research “a monstrous practice that causes [the monkeys] to suffer.” 

Whether it be for conservation, de-extinction, livestock use, or medical research, proponents solve animal cloning’s moral question by the adage, “the ends justify the means.” Specifically, the benefit to humanity through animal cloning outweighs any suffering and health-risk, or even purposeful manipulation to cause disease, caused through the cloning process. 

It’s vital to be abundantly clear. Just like the editors of Scientific American advocated using animal cloning for the conservation of endangered species, but shunned de-extinction, there is no single ethical solution amongst the varied domains of cloning science. 

The Debrief set out to examine the pros and cons of animal cloning. However, once one digs into the topic, one finds there is no simple answer. There is no universal conclusion as to whether cloning is fundamentally a positive or negative thing. 

There are compelling arguments on both sides, with some avenues, such as cloning for conservation, seemingly more acceptable. In these instances, realizing the alternative means the loss of an entire species can mitigate the pain, suffering, or low “efficiency” involved in the process. 

Meanwhile, other areas, such as cloning for medical research, even when that research may benefit humankind, leave one with a sense of disgust and simply feel morally wrong. 

Should science be involved in the cloning animals? Vote and let us know your thoughts in the comments. Make sure to check out The Debrief’s feature coming out today where we examine -The Pros and Cons of Animal Cloning. — The Debrief (@Debriefmedia) February 25, 2021

Some may argue that science is the quest for objective knowledge and should be divorced from ethical considerations. However, this view discounts the fact that, as the pursuers of knowledge, human beings are creatures capable of taking a holistic view and considering the broader consequences of their actions. 

Going back to Yellowstone National Park’s case, the overpopulation of deer and elk caused the depletion of natural resources, negatively impacting the entire ecosystem. Yet, these acts were not immoral, and the animals were incapable of measuring the consequences of their overconsumption. 

Conversely, human beings cannot claim such ignorance. We are more than capable of discerning the impact of our actions on ourselves and the world around us. We must use that holistic lens when examining animal cloning to measure risk vs. reward, both in the near and short term, and the principled impact on society. 

Ultimately, Dr. Shapiro best sums up the dilemma of animal cloning in her book, How to Clone a Mammoth: The Science of De-Extinction . Describing her work examining how to resurrect extinct species, Dr. Shapiro calls it “Exhilarating because of the unprecedented opportunities to understand life and boost conservation efforts, but terrifying in part for its ethical quandaries.”

Join us on Twitter or Facebook to weigh in and share your thoughts on the pros and cons of animal cloning. You can also follow all the latest  news and exciting feature content from The Debrief on Flipboard , Instagram , and don’t forget to subscribe to The Debrief YouTube Channel and check out The Official Debrief Podcast . 

Should science be involved in the cloning animals? Let us know your thoughts in the comments and make sure to check out… Posted by The Debrief on  Thursday, February 25, 2021

Animal cloning

So Dolly was not the first clone, and she looked like any other sheep, so why did she cause so much excitement and concern? Because she was the first mammal to be cloned from an adult cell, rather than an embryo. This was a major scientific achievement, but also raised ethical concerns. Since 1996, when Dolly was born, other sheep have been cloned from adult cells, as have mice, rabbits, horses and donkeys, pigs, goats and cattle. In 2004 a mouse was cloned using a nucleus from an olfactory neuron, showing that the donor nucleus can come from a tissue of the body that does not normally divide.  

How was Dolly created?

Producing an animal clone from an adult cell is obviously much more complex and difficult than growing a plant from a cutting. So when scientists working at the Roslin Institute in Scotland produced Dolly, the only lamb born from 277 attempts, it was a major news story around the world. To produce Dolly, the scientists used the nucleus of an udder cell from a six-year-old Finn Dorset white sheep. The nucleus contains nearly all the cell's genes. They had to find a way to 'reprogram' the udder cells - to keep them alive but stop them growing – which they achieved by altering the growth medium (the ‘soup’ in which the cells were kept alive). Then they injected the cell into an unfertilised egg cell which had had its nucleus removed, and made the cells fuse by using electrical pulses. The unfertilised egg cell came from a Scottish Blackface ewe. When the scientists had managed to fuse the nucleus from the adult white sheep cell with the egg cell from the black-faced sheep, they needed to make sure that the resulting cell would develop into an embryo. They cultured it for six or seven days to see if it divided and  developed normally, before implanting it into a surrogate mother, another Scottish Blackface ewe. Dolly had a white face. From 277 cell fusions, 29 early embryos developed and were implanted into 13 surrogate mothers. But only one pregnancy went to full term, and the 6.6kg Finn Dorset lamb 6LLS (alias Dolly) was born after 148 days.

Why are scientists interested in cloning?

The main reason that the scientists at Roslin wanted to be able to clone sheep and other large animals was connected with their research aimed at producing medicines in the milk of such animals. Researchers have managed to transfer human genes that produce useful proteins into sheep and cows, so that they can produce, for instance, the blood clotting agent factor IX to treat haemophilia or alpha-1-antitrypsin to treat cystic fibrosis and other lung conditions. Cloned animals could also be developed that would produce human antibodies against infectious diseases and even cancers. ‘Foreign’ genes have been transplanted into zebra fish, which are widely used in laboratories, and embryos cloned from these fish express the foreign protein. If this technique can be applied to mammalian cells and the cells cultured to produce cloned animals, these could then breed conventionally to form flocks of genetically engineered animals all producing medicines in their milk. There are other medical and scientific reasons for the interest in cloning. It is already being used alongside genetic techniques in the  development of animal organs for transplant into humans (xenotransplantation). Combining such genetic techniques with cloning of pigs (achieved for the first time in March 2000) would lead to a reliable supply of suitable donor organs. The use of pig organs has been hampered by the presence of a sugar, alpha gal, on pig cells, but in 2002 scientists succeeded in knocking out the gene that makes it, and these ‘knockout’ pigs could be bred naturally. However, there are still worries about virus transmission. The study of animal clones and cloned cells could lead to greater understanding of the development of the embryo and of ageing and  age-related diseases. Cloned mice become obese, with related symptoms such as raised plasma insulin and leptin levels, though their offspring do not and are normal. Cloning could be used to create better animal models of diseases, which could in turn lead to further progress in understanding and treating those diseases. It could even enhance biodiversity by ensuring the continuation of rare breeds and endangered species.  

What happened to Dolly?

Dolly, probably the most famous sheep in the world, lived a pampered existence at the Roslin Institute. She mated and produced normal offspring in the normal way, showing that such cloned animals can reproduce. Born on 5 July 1996, she was euthanased on 14 February 2003, aged six and a half. Sheep can live to age 11 or 12, but Dolly suffered from arthritis in a hind leg joint and from sheep pulmonary adenomatosis, a virus-induced lung tumour to which sheep raised indoors are prone. On 2 February 2003, Australia's first cloned sheep died unexpectedly at the age of two years and 10 months. The cause of death was unknown and the carcass was quickly cremated as it was decomposing. Dolly’s chromosomes were are a little shorter than those of other sheep, but in most other ways she was the same as any other sheep of her chronological age. However, her early ageing may reflect that she was raised from the nucleus of a 6-year old sheep. Study of her cells also revealed that the very small amount of DNA outside the nucleus, in the mitochondria of the cells, is all inherited from the donor egg cell, not from the donor nucleus like the rest of her DNA. So she is not a completely identical copy. This finding could be important for sex-linked diseases such as haemophilia, and certain neuromuscular, brain and kidney conditions that are passed on through the mother's side of the family only.  

Improving the technology

Scientists are working on ways to improve the technology. For example, when two genetically identical cloned mice embryos are combined, the aggregate embryo is more likely to survive to birth. Improvements in the culture medium may also help.  

Ethical concerns and regulation

Most of the ethical concerns about cloning relate to the possibility that it might be used to clone humans. There would be enormous technical difficulties. As the technology stands at present, it would have to involve women willing to donate perhaps hundreds of eggs, surrogate pregnancies with high rates of miscarriage and stillbirth, and the possibility of premature ageing and high cancer rates for any children so produced. However, in 2004 South Korean scientists announced that they had cloned 30 human embryos, grown them in the laboratory until they were a hollow ball of cells, and produced a line of stem cells from them. Further ethical discussion was raised in 2008 when scientists succeeded in cloning mice from tissue that had been frozen for 16 years. In the USA, President Clinton asked the National Bioethics Commission and Congress to examine the issues, and in the UK the House of Commons Science and Technology Committee, the Human Embryology and Fertilisation Authority and the Human Genetics Advisory Commission all consulted widely and advised that human cloning should be banned. The Council of Europe has banned human cloning: in fact most countries have banned the use of cloning to produce human babies (human reproductive cloning). However, there is one important medical aspect of cloning technology that could be applied to humans, which people may find less objectionable. This is therapeutic cloning (or cell nucleus replacement) for tissue engineering, in which tissues, rather than a baby, are created. In therapeutic cloning, single cells would be taken from a person and 'reprogrammed' to create stem cells, which have the potential to  develop into any type of cell in the body. When needed, the stem cells could be thawed and then induced to grow into particular types of cell such as heart, liver or brain cells that could be used in medical treatment. Reprogramming cells is likely to prove technically difficult. Therapeutic cloning research is already being conducted in animals, and stem cells have been grown by this method and transplanted back into the original donor animal. In humans, this technique would revolutionise cell and tissue transplantation as a method of treating diseases. However, it is a very new science and has raised ethical concerns. In the UK a group headed by the Chief Medical Officer, Professor Liam Donaldson, has recommended that research on early human embryos should be allowed. The Human Fertilisation and Embryology Act was amended in 2001 to allow the use of embryos for stem cell research and consequently the HFEA has the responsibility for regulating all embryonic stem cell research in the UK. There is a potential supply of early embryos as patients undergoing in-vitro fertilisation usually produce a surplus of fertilised eggs. As far as animal cloning is concerned, all cloning for research or medical purposes in the UK must be approved by the Home Office under the strict controls of the Animals (Scientific Procedures) Act 1986 . This safeguards animal welfare while allowing important scientific and medical research to go ahead.  

Further information

The Roslin Institute has lots of information about the research that led to Dolly, and the scientific studies of Dolly, as well as links to many other sites that provide useful information on the scientific and ethical aspects of this research. The report of the Chief Medical Officer's Expert Advisory Group on Therapeutic Cloning: Stem cell research: medical progress with responsibility is available from the UK Department of Health , PO Box 777, London SE1 6XH. Further information on therapeutic cloning and stem cell research is available from the Medical Research Council . Interesting illustrated features on cloning have been published by Time , New Scientist . BBC News Online has a Q&A What is Cloning?   IMAGE © THE ROSLIN INSTITUTE

Featured news

Ten organisations account for half of all animal research in Great Britain in 2023

Animal research statistics for Great Britain, 2023

Could AI replace animal research?

Subscribe to our newsletter.

Get the latest articles and news from Understanding Animal Research in your email inbox every month. For more information, please see our  privacy policy .

Journals By Subject

• Proceedings

Information

Scientific and Ethical Implications of Human and Animal Cloning

Sidra Shafique

Department of Biomedical and Molecular Sciences, Queen’s University, Kingston, Ontario, Canada

Contributor Roles: Sidra Shafique is the sole author. The author read and approved the final manuscript.

Add to Mendeley

Cloning is an old paradigm with new ethical issues that society is confronting today and will do so tomorrow. In this publication, cloning has been reviewed from the perspective of its broad implications on research, agriculture, pets, sports animals and humans. Reflection of legal status shows a picture of cloning applications that is not only inevitable but expected to change human species forever. Weighing advantages vs disadvantages of either the reproductive cloning or therapeutic one sums up into unnatural acts, changing the diversity of society and risks of exploitation. Modern biotechnology can only clone the genomes, not the individuals. Cultural inheritance comes from the development and adaptation of individuality generation after generation. The biological inheritance may be copied but the cultural inheritance cannot be duplicated. Human cloning infringes upon the principles of individual freedom, identity, and autonomy. Here, the current impacts of cloning are elaborated in comparison to the past and predicting what could happen tomorrow. In any scenario, public discussion and involvement of society must be preceded by making or amending laws and regulations. Risk assessment, enforcing justice and altered explanation of ‘words’ and ‘definitions might be the next stance for bioethicists and lawyers shortly. However, scientists and the regulatory authorities are of the view that the way IVF and animal cloning have been gradually accepted, the fourteen days blastocyst cultivation has been justified, one day the human cloning will also get the approval of a common man. As science will advance, the ethicist and theologists would come up with a favorable argument too, maybe three decades from now. In the present publication, the issue of cloning in general with a focus on human cloning, in particular, is discussed understandably by everyone interested in cloning and its impacts on society.

Human Cloning, Animal Cloning, Ethical Issues, Reproductive Cloning, Legislation, Cultural Inheritance

Sidra Shafique. (2020). Scientific and Ethical Implications of Human and Animal Cloning. International Journal of Science, Technology and Society , 8 (1), 9-17. https://doi.org/10.11648/j.ijsts.20200801.12

Sidra Shafique. Scientific and Ethical Implications of Human and Animal Cloning. Int. J. Sci. Technol. Soc. 2020 , 8 (1), 9-17. doi: 10.11648/j.ijsts.20200801.12

Sidra Shafique. Scientific and Ethical Implications of Human and Animal Cloning. Int J Sci Technol Soc . 2020;8(1):9-17. doi: 10.11648/j.ijsts.20200801.12

Cite This Article

• Author Information

Verification Code/

The captcha is required.

Captcha is not valid.

Verification Code

Science Publishing Group (SciencePG) is an Open Access publisher, with more than 300 online, peer-reviewed journals covering a wide range of academic disciplines.

Learn More About SciencePG

• Special Issues
• AcademicEvents
• ScholarProfiles
• For Authors
• For Reviewers
• For Editors
• For Conference Organizers
• For Librarians
• Article Processing Charges
• Special Issues Guidelines
• Editorial Process
• Peer Review at SciencePG
• Open Access
• Ethical Guidelines

Important Link

• Manuscript Submission
• Propose a Special Issue
• Join the Editorial Board
• Become a Reviewer

• Essay Editor

Animal Cloning Benefits and Controversies Essay

1. introduction.

A 1996 press conference was called when a group of Scottish scientists reported a seemingly impossible event. Born the previous year, Dolly, an otherwise average sheep, was to undergo a genetic test. Not only did the test confirm that Dolly was not a twin, but also that the origin of her genetic code was quite exceptional: she was a clone, a replica from the genetic code of a single cell of sheep adulthood. Since then, the cloning of mammals from nonreproductive cells is in the stage where it is feasible in many species of mammals. In the meanwhile, a cloned cat, some cattle and pigs, a mule, and a few more sheep have arrived. So what are the circumstances in which scientists feel compelled to create cloned animals? And what is the reason for remarkable animal cloning achievements and, on the other hand, for such strong resistances against them? In this review, we will start with a short overview of the technology and its current state, and we will discuss some important biological considerations associated with animal cloning. While some may use a very wide interpretation, usually animal cloning refers to a group of cloning technologies by which a group of genetically identical animals are created. It differs from other reproductive technologies, such as inbreeding, artificial selection, and artificial insemination, in that it uses modern cell and molecular techniques instead of generation-spanning methods to create an offspring with a certain genetic composition. At this moment, five approaches are applied to create cloned animals. Regardless of the type of methods, such as natural, demist natural, artificial, or sheer ear of experience, all of these approaches have in common that they start from a differentiated or a dedifferentiated cell that is put in a state from which they can develop into a complete organism again.

1.1. Background and Definition

Animal cloning, or molecular cloning of nuclei, is a scientific technique used to create an animal that is genetically identical to an existing animal. When the molecular clone is derived from the same female donating the nuclei, the resulting animals are called true clones. When it is derived from an individual that has already produced one offspring, the resulting animals are referred to as recombinant clones or half-clones. With such technology, it is possible to create animals that are genetically identical to improved animals that have already been tested and proven to be of superior quality. Cloning can also provide a means to rescue animals that would otherwise be lost or injured. The production of multiple copies of such animals would have a profound economic impact on animal agriculture. There are many other applications of cloning technology that can benefit various agricultural industries. Cloning can produce animals with certain genes turned off (commonly referred to as knockout animals) to study the function of particular genes involved in certain diseases. Other biotechnologies such as gene transfer, in vitro fertilization, transgenesis, and the use of embryonic stem (ES) cells can go a long way in capturing some of these advantages. However, cloning technology provides a direct method to achieve such results. This is one of the main reasons the technique has attracted the attention of scientists and the public. What makes cloning possible is a special kind of cell in the body, called a somatic cell, that holds the DNA of the body. All animals have them.

2. Benefits of Animal Cloning

The greatest advantage of animal cloning lies in the conservation of infertile, superior animals, as it enables the rapid expansion of desired genetic traits. It allows the optimal replication of characteristics including growth, resistance, temperament, and efficiency. Cloning can make it possible to selectively save and multiply haploid, lethal, or genetic anomalous animals, which would be impossible to recreate naturally due to infertility or low reproductive ability. It is crucial that the sense of infertility of the superior animal is lost due to the unsuccessful completion of its reproduction after its death. Cloning is also considered an effective reproductive system for the conservation and propagation of valuable genetic resources, including the creation of reconstituted breeds from dead animals. It guarantees the conservation of genes from a germline with vastly superior characteristics - not yet surpassed genetically - and induces genetic reconstitution when associated with conventional genetic selection techniques. The cloning of the last representative of a breed, as the germline that has been preserved, may be of great importance for its recovery. From the standpoint of animal welfare, reproductive cloning technology provides possibilities for the restoration of genes that are beneficial to animal health and well-being.

2.1. Improving Livestock Quality

One of the main benefits of animal cloning is expected to be the improvement of livestock quality (weight gain, milk, meat quality, disease resistance, etc.), since a clone is expected to be identical to the parent animal from which it was generated. The improvement in livestock quality using traditional methods of genetic improvement is possible over a considerable period, which increases the cost and time invested. Cloning provides the possibility of creating clones from animals with desirable characteristics for different purposes. The possibility of cloning animals with milk or meat of the highest quality, as well as disease-resistant animals, contributes significantly to the improvement of livestock quality, perpetuating the gene and guaranteeing the production of animals immediately after cloning. The dairy and beef industries, as well as the pig industry, are expected to benefit from cloning, since the genetic potential of females and males with the best milk or meat quality qualities can be perpetuated. Furthermore, these industries are one of the sectors of the economy with the most rapid advances in biotechnology, which will make it easier for clones to enter other areas of biotechnology. This means that cloned animals will be of interest not only to the agricultural sector but also to many areas of biomedicine whose interest lies in the areas of molecular genetics and molecular biology or in applying gene therapy, for example.

2.2. Biomedical Research Advancements

There are several goals for conducting research in animal cloning using large mammals. All of these proposed research avenues seek to contribute to basic biological and medical or agricultural knowledge. They are expected to produce new biological knowledge across diverse areas with varying impacts on many objectives. For example, various aspects of agriculture are likely to be affected, the human food supply and public health, as well as quality of life and potential economic benefits. However, it is anticipated that the knowledge generated will require various degrees of scrutiny by society resulting from potential implementation of new biotechnologies developed using live animals. Although animal cloning has many potential applications ranging from pharmaceutical production to animal conservation, its current limitations are primarily technical. For example, the inability of the technology to produce genetically tailored tissues or whole animals from single stem cells and the low success rates of nuclear transfer greatly restrict the utility of cloning in most animals. By further analyzing the epigenetic pattern present in embryos created via nuclear transfer, studying the influence of oocytes during preimplantation embryonic development and testing various techniques to modify gene expression patterns, it is possible that more efficient cloning strategies may be devised. Although reverse genetic approaches can now be used to create targeted mutations in a variety of animal species, cloning can serve as an independent and complementary method of verifying a gene's function.

3. Controversies Surrounding Animal Cloning

There are several arguments against cloning, but the two most important are the moral and ethical implications of cloning animals because they involve the creation of genetically identical animals and the lack of control over the cloning process. The latter is particularly important as its lack implies an additional risk for creating sick animals. Animals that look healthy can actually suffer from fitness problems, some of which are life-threatening. The link between clones and certain fetal and placental overgrowth disorders is quite intriguing. In comparison with the benefits of cloning described previously, the concerns are quite different. When breeding animals in the traditional way, genetic variations are built into the population to help the species adapt to changing behaviors or a changing environment. But cloned animal populations contain little variation. Only a very few individuals were used to generate the clones and, for example, if a breed of animal is suffering from a particular disease inherited by a certain defective gene, you risk that same defective gene in the donor animal could become common in the current population of copies and future generations of copies. Guo and his colleagues used a single sow to generate 186 sibling clones, with the result that all of them had the same pig genomics, including a health-related gene (RIG-I). This lack of genetic variation undermines the health and welfare of the animals and can potentially make populations more vulnerable to disease.

3.1. Ethical Concerns

Dolly's successful cloning does not mean that the current ability in animal cloning is free from ethical problems. Production of cloned animals for use in research is another example in which serious animal welfare concern arises. As mentioned above, somatic cell cloning efficiency is extremely low, implying that these prior cloned animals did not, therefore, correctly die according to a correct culling plan, although the technique is known to be harmful to the animals. Increased postnatal death rates are unique conditions associated with the unfavorable pregnancies of somatic cell cloned fetuses. These reveal that the somatic cell cloning technique is not optimal, although normal offspring can be sometimes generated. If we want to continue to perform somatic cell cloning with animal fetuses as material, it should be recognized that its likely outcome from efficient somatic cell cloning is nothing but teratogenic, i.e. the deformation of the bodies of the offspring. These give rise to the questions of how the federal government is to generate these deformed fetuses in the mother. It is questionable whether the practical interests of the farmers and science researchers have adequately assumed the researcher's priority to generate these deformed fetuses in their viewpoint, after their abnormality has factually happened under significantly reduced pregnancy risk in their monkey relative.

3.2. Environmental Impact

In addition to the previously mentioned concerns about the possible impact of cloned animals or their offspring on other animals or on humans, there are also other potential concerns with cloning. Every contemporary biotechnology, from antibiotics to transgenics, has an environmental impact and animal cloning is no exception. The point in the article is not to identify specific concerns we have about animal cloning, but to expand the range of our possible concerns beyond human needs and health, valuing the animal as a being in itself, whose development and life has its moral significance. The genetic defects and consequential diseases in the cloned animals are a weighty concern about the use of SCNT, because we are creating animals that are predisposed to numerous health and welfare problems. These defective animals contradict animal cloning's claim of advancing the production of consumable (i.e., food or industrial products), drugs, product testing, or functional tissues from which to cure human being pathologies. There are, indeed, significant limitations in the use of therapeutic cloning and nuclear transfer for animal cloning. Measures to prevent any cloned animals from being inherited in the food supply should be carried out. It also highlights the use of cloning on a very small scale, by focusing on applications close to human health.

4. Conclusion

It is important to keep in mind the complexity of biological phenomena, as well as to differentiate the potential outcomes of scientific research from uses that are unethical in view of human dignity and the rights of the individual. Technology should not be seen as an end in itself, because its end is the complete wellbeing of all work. Thanks to reflection, experimentation, and sharing of knowledge, man constantly fulfills his vocation by which all his actions should aim to develop a world suited to him and his growth. Cloned animals can offer an impressive and welcome answer which will help to resolve what we may consider the "crisis of knowledge" in life sciences, while contributing to the aims stated in the new Federation of Animal Science Societies' roadmap. We wish that the coming of animal cloning may be respected in terms of its future potentialities for society and may contribute positively in the perspective of the animal world in order to contribute effectively to the improvement of human life on this earth. We trust in fact, and we are not afraid to say so with conviction, that animal cloning may be a great and useful ally of man.

4.1. Summary of Key Points

Scientific research offers compelling benefits to both humans and animals. Utilitarian arguments often find scientific research with animals to be justified primarily by appealing to one set of specific advantages, namely, benefits to humans. In this view, it is legitimate to use animals for scientific research in order to solve human health problems, produce biomedically relevant knowledge, or develop beneficial veterinary medicines. In these arguments, suffering of animals is considered a classic moral disutility, to be reduced or eliminated to the extent that is possible, but only within the limits of not interfering significantly with the achievement of maximized net human welfare benefits. Other animals are basically regarded as instrumental means to human ends. However, there may be "downsides" to such one-sided instrumental treatment of other complex and sentient beings. These "downsides" (in the way of political responses, psychological effects, ethical justification, etc.) will not be discussed here, except for the risks of animal bio-cloning as a specific example of animal-centered stakeholder interests in scientific research. The instrumental use of animals for scientific research must be carefully examined regarding Animal Welfare and the role of animal stakeholders. Looking briefly at the entire spectrum of creating or having (and having the opportunity to withhold) interests, it is obvious that animals which are being used in bio-scientific research are owner-less property, "habeas materials". They afford legal and ethical proposals according to their individual welfare needs. Such a view is often seen as radical. Regulatory-driven interest representation concentrates on animals in captivity, their physical condition far exceeding their more relevant social environment. The genetic, behavioral, health, and social as well as physical needs of specific animal populations that are used as research materials in various scientific disciplines are often optimized. Guidelines and laws regulate the care and use of animals in scientific research. ANIMAL CARE in civilized societies are the result of a pluralistic and democratic discourse on reconciling human and animal interests. The legitimacy of guidelines and legislation pertaining to the use of animals in scientific research are judged primarily by taking the relevant stakeholders into account. Even though European and American guidelines and laws do not recognize non-human animal entities as stakeholders, it is morally defendable to include these animals. Livestock interests may be better served in some individual research cases when considering animals as legitimate "welfarists". A specific need of interest-representation evolves in the domain of Animal Bio-Cloning.

Related articles

The impact of human activities on the environment and ways to promote sustainability.

1. Introduction The environment encompasses all living and nonliving things occurring naturally. It is crucial to the existence and survival of living things. However, human activities have often led to the deterioration of the environment. Over the years, increasing scientific evidence has shown that different forms of pollution (air, water, and land) have resulted in the greenhouse effect, depletion of the ozone layer, and acid rain, all of which have contributed to global warming and climate ...

The Impact of Technological Advancements on Sustainability and Predictability in Modern Societies

1. Introduction Modern societies depend on an infrastructure that delivers electricity to support economic, health, and social development. This chapter argues that new innovations in information and communication technology (ICT) power systems offer the opportunity to introduce systematic change leading to modern, sustainable power systems within 20-30 years. Some global challenges such as the manipulation of our climate system and the pressures on biodiversity loss can be ascribed to the glob ...

Exploring the Environmental and Cultural Diversity of Costa Rica and Its Impact on Tourism

1. Introduction The purpose of the present conceptual paper is to report on research conducted in Costa Rica about cultural insights into all these particular phenomena and their relationships, the histories underlying them, and the attitudes and responses of a cross-section of their inhabitants to several problems generated by increased tourism. Costa Rica offers unique opportunities for studying the totality of problems and means to solve them, due to environmental and cultural attributes ass ...

The Impact of Urban Development on the Environment: An Analysis of 'El Plano' in City Planning

1. Introduction Biological urbanism conceives the city as a large form, a bio-habitat that, like a natural substrate, is the support of an abundant life. The structure that underlies forms a base that can be called 'the floor'. The present work uses the concept 'terraces' of the Enric Granados Plan as a personification of lifeless floors, achieved through flat and abstract rationalism. The research establishes an analogy between the environmental impact of 'The Plan' and that of 'El Plano' with ...

The Environmental Impact of Deforestation and the Importance of Preserving Tree Species in Maintaining Biodiversity and Ecological Balance

1. Introduction Deforestation, the removal of forested areas, is a major problem in many regions of the world where it not only serves to remove the sinks for the carbon dioxide we humans generate in great quantities, but also is the method for shifting the array of plant and animal species that make up these montane and lowland rainforest systems. It was in one such system, the lowland rainforest situated along the Amazon river of Brazil, that I encountered both the environmental problem of de ...

La importancia del rescate de animales en peligro de extinción

1. Introducción La vida del planeta, ciertamente, está amenazada. Si algo deseamos desenmascarar cuanto antes, hagamos del rescate de animales en peligro de extinción las grandes fábulas de ejemplos e historias longevas. Merece la pena que asistamos de cerca. En un rincón donde aún no alcanzamos a hacernos del todo dueños, pero que sabemos compartido por un innumerable número de especies vistosas, avezadas y extraordinariamente dotadas. De igual manera, suele llamarse albacea de lo mejor de est ...

The Impact of Volcanic Eruptions on Climate Change: A Case Study of Mount Pinatubo

1. Introduction The general perception regarding climate change is that it is mainly induced by man, particularly due to the increase in the release of greenhouse gases from activities such as industrialization and increasing use of fossil fuels. The impact of these activities has been recognized and has been receiving increasing attention in recent years, leading to a number of international protocols where countries are encouraged and required to control and/or reduce the levels of these gase ...

The Importance of Environmental Conservation

1. Introduction The natural environment is the foundation upon which other human societal functions are built. Indeed, the human race is dependent upon the earth's biotic life support system for food, clean air, freshwater, fertile soil, and protection from the harmful effects of ultraviolet solar radiation. Human society is also reliant upon diverse ecosystems for essential ecosystem goods and services which are the sine qua non for the general welfare of human societies, and which transmit th ...

• History & Society
• Science & Tech
• Biographies
• Animals & Nature
• Geography & Travel
• Arts & Culture
• Games & Quizzes
• On This Day
• One Good Fact
• New Articles
• Lifestyles & Social Issues
• Philosophy & Religion
• Politics, Law & Government
• World History
• Health & Medicine
• Browse Biographies
• Birds, Reptiles & Other Vertebrates
• Bugs, Mollusks & Other Invertebrates
• Environment
• Fossils & Geologic Time
• Entertainment & Pop Culture
• Sports & Recreation
• Visual Arts
• Demystified
• Image Galleries
• Infographics
• Top Questions
• Britannica Kids
• Saving Earth
• Space Next 50
• Student Center
• Introduction & Top Questions
• Early cloning experiments

Reproductive cloning

Therapeutic cloning.

• Ethical controversy

• What is cloning?
• Why is cloning controversial?
• When did science begin?
• Where was science invented?

Our editors will review what you’ve submitted and determine whether to revise the article.

• National Geographic - Cloning
• Stanford Encyclopedia of Philosophy - Cloning
• Internet Encyclopedia of Philosophy - Cloning
• National Human Genome Research Institute - ​Cloning Fact Sheet
• National Center for Biotechnology Information - Cloning: Definitions And Applications
• CellPress - Robert Koch: The Grandfather of Cloning?
• Academia - Dolly and the history of cloning
• Live Science - How does cloning work?
• Biology LibreTexts - Cloning
• WebMD - The Facts and Fiction of Cloning
• BCcampus Open Publishing - Plasmids and Cloning Basics
• cloning - Children's Encyclopedia (Ages 8-11)
• cloning - Student Encyclopedia (Ages 11 and up)
• Table Of Contents

Reproductive cloning involves the implantation of a cloned embryo into a real or an artificial uterus . The embryo develops into a fetus that is then carried to term. Reproductive cloning experiments were performed for more than 40 years through the process of embryo splitting, in which a single early-stage two-cell embryo is manually divided into two individual cells and then grows as two identical embryos. Reproductive cloning techniques underwent significant change in the 1990s, following the birth of Dolly , who was generated through the process of SCNT . This process entails the removal of the entire nucleus from a somatic (body) cell of an organism, followed by insertion of the nucleus into an egg cell that has had its own nucleus removed (enucleation). Once the somatic nucleus is inside the egg, the egg is stimulated with a mild electrical current and begins dividing. Thus, a cloned embryo, essentially an embryo of an identical twin of the original organism, is created. The SCNT process has undergone significant refinement since the 1990s, and procedures have been developed to prevent damage to eggs during nuclear extraction and somatic cell nuclear insertion. For example, the use of polarized light to visualize an egg cell’s nucleus facilitates the extraction of the nucleus from the egg, resulting in a healthy, viable egg and thereby increasing the success rate of SCNT.

Reproductive cloning using SCNT is considered very harmful since the fetuses of embryos cloned through SCNT rarely survive gestation and usually are born with birth defects. Wilmut’s team of scientists needed 277 tries to create Dolly . Likewise, attempts to produce a macaque monkey clone in 2007 involved 100 cloned embryos, implanted into 50 female macaque monkeys, none of which gave rise to a viable pregnancy . In January 2008, scientists at Stemagen, a stem cell research and development company in California, announced that they had cloned five human embryos by means of SCNT and that the embryos had matured to the stage at which they could have been implanted in a womb. However, the scientists destroyed the embryos after five days, in the interest of performing molecular analyses on them.

Therapeutic cloning is intended to use cloned embryos for the purpose of extracting stem cells from them, without ever implanting the embryos in a womb. Therapeutic cloning enables the cultivation of stem cells that are genetically identical to a patient. The stem cells could be stimulated to differentiate into any of the more than 200 cell types in the human body . The differentiated cells then could be transplanted into the patient to replace diseased or damaged cells without the risk of rejection by the immune system . These cells could be used to treat a variety of conditions, including Alzheimer disease , Parkinson disease , diabetes mellitus , stroke , and spinal cord injury. In addition, stem cells could be used for in vitro (laboratory) studies of normal and abnormal embryo development or for testing drugs to see if they are toxic or cause birth defects.

Although stem cells have been derived from the cloned embryos of animals such as mice, the generation of stem cells from cloned primate embryos has proved exceptionally difficult. For example, in 2007 stem cells successfully derived from cloned macaque embryos were able to differentiate into mature heart cells and brain neurons . However, the experiment started with 304 egg cells and resulted in the development of only two lines of stem cells, one of which had an abnormal Y chromosome . Likewise, the production of stem cells from human embryos has been fraught with the challenge of maintaining embryo viability. In 2001 scientists at Advanced Cell Technology, a research company in Massachusetts, successfully transferred DNA from human cumulus cells, which are cells that cling to and nourish human eggs, into eight enucleated eggs. Of these eight eggs, three developed into early-stage embryos (containing four to six cells); however, the embryos survived only long enough to divide once or twice. In 2004 South Korean researcher Hwang Woo Suk claimed to have cloned human embryos using SCNT and to have extracted stem cells from the embryos. However, this later proved to be a fraud; Hwang had fabricated evidence and had actually carried out the process of parthenogenesis , in which an unfertilized egg begins to divide with only half a genome. The following year a team of researchers from the University of Newcastle upon Tyne was able to grow a cloned human embryo to the 100-cell blastocyst stage using DNA from embryonic stem cells, though they did not generate a line of stem cells from the blastocyst. Scientists have since successfully derived embryonic stem cells from SCNT human embryos.

Progress in research on therapeutic cloning in humans has been slow relative to the advances made in reproductive cloning in animals. This is primarily because of the technical challenges and ethical controversy arising from the procuring of human eggs solely for research purposes. In addition, the development of induced pluripotent stem cells , which are derived from somatic cells that have been reprogrammed to an embryonic state through the introduction of specific genetic factors into the cell nuclei, has challenged the use of cloning methods and of human eggs.

The Cloning Controversy Argumentative Essay

• To find inspiration for your paper and overcome writer’s block
• As a source of information (ensure proper referencing)
• As a template for you assignment

Introduction

Argument against cloning, argument for cloning, works cited.

Despite the promising future that cloning purports to forecast for the human race, the research projects have been met with fierce opposition from lawmakers to clergy men. Most of the opposition is on ethical grounds and while there is nothing unethical about using technology to save lives, opposition groups are far from being appeased.

Considering the fact that most of the controversy about cloning arises from misinformation or ignorance about the matter, this study shall set out to conclusively research on cloning and its merits so as to attest whether the lack of unanimous support for therapeutic cloning and explicit ban of human cloning is justifiable.

Cloning is described as the creation of genetically identical organisms by use of artificial means (Kfoury 112). Cloning is deemed as a form of asexual reproduction whereby a gene from one animal/human is transferred to another organism. The process by which this is carried out is often complicated and requires cutting edge technology.

The two major forms of cloning are the Reproductive and therapeutic cloning. Reproductive cloning involves the generation of animals that have identical DNA with previously existing animals (Mollard 1). Cloning of human beings would fall under this category. This procedure is carried out by copying the DNA information from the donor’s nucleus into a cell with the nucleus previously removed (Mollard 2). The cell grows into a replica of the animal which provided the gene once it is fully developed.

Therapeutic cloning follows the same steps as reproductive cloning only that the embryos development is not let to run to completion. Therapeutic cloning is mainly used to extract stem cells from embryos. After the successful retrieval of the cells, the embryos are inevitably destroyed (Kfoury 112). Research on stem cells has it that these unspecialized cells have the ability to transform themselves into any type of cell found in the body.

There has been agreement by consensus that human cloning should be banned though the prospects of the same are at best distant. The major arguments in support of this assertion is the concern that cloning could lead to physically deformed children and furthermore pose a danger to the women who act as surrogate mothers to the clones (Pearson 658). It is noteworthy to point out that these fears are not unfounded since cloning of animals has resulted to some undesirable characteristics being exhibited in the clone.

Research shows that cloned animals that survive end up being bigger at birth than natural animals. This condition is not only hazardous to the mother but also can lead to breathing problems and a myriad of other complications (Pearson 658). The mortality rate of cloned animals is also observed to be very high with most of them hardly lasting through a few months (Mollard 2).

New cloning techniques open up the possibility of reproductive cloning hereby human beings could be created! Kfoury paints quite a bleak image on the outcome of cloning by alluding to a possibility that people could have clones and then use these clones to “harvest” organs needed to be transplanted into them when their own organs have failed or are sickly (113).

This scary possibility is further made real by the critical shortage of organs for such surgeries and the very questionable moral ethics of some governments which could assent with such outrageous practices.

Cloning technology as it presently stands is haunted by huge failure rates (Mollard 2). This is one of the facts that detractors to cloning are quick to point out in their arguments against the justification of cloning. In the first successful cloning of the sheep, it is recorded that 277 enucleated eggs were obtained and received nuclei from an adult mammary gland cell.

Of these, only 29 cells made it to the next blastocyst stage. The new cells were placed in the uteruses of 13 ewes but only one sheep was eventually born. This success rate of a mere 0.36% is seen as unjustifiable considering the efforts that go into the cloning process.

Another venue from which opposition to the cloning process is brought into light is by a woman’s study by Mollard (2). He asserts that while the debate rages on about reproductive cloning and step cell research efforts, women who supply the eggs for the cloning efforts are given no merit or credit at that.

The health risks associated with the egg extraction process are seen to be great and in light of the high rate of failure currently associated with the cloning process, Mollard contests that serious ethical implications are raised regarding the process (2).

From a medical point of view, cloning also presents a new way in which research into diseases can be undertaken. It is articulated that animals that carry genetic defect that mimic human diseases can be generated through cloning (North Carolina Association for Biomedical Research 2). These “sickly” animals could then be used for the study of the diseases and the findings obtained from this would be of immense value in finding of effective therapies for treating the disease in humans (Wolfe 3).

Sadly, majority of the people awaiting organs for transplant will end up not receiving the much needed organs. Therapeutic cloning presents a long term solution to this problem which is only set to escalate.

Cloning of individual human organs e.g. the kidney, heart, etc. presents a novel way of coming up with organs for transplant as patients will no longer have to rely on the altruist tendencies of fellow men, which cannot always be guaranteed (Lanza 283). In addition, this cloning will ensure that organ rejection is a thing of the past (Kfoury 113).

In addition to these prospects of creating high quality breeds in industrial scale numbers, there is also the possibility of modifying the DNA of the clones such that they posses some key proteins that are not normally present in the animal but are of huge benefit to human beings (Lanza 283). This can lead to the increasing in the nutritional worth of the animals and the presentation of healthier food products for people since the nutritional composition of the product can be “tweaked” to best suit the consumer. This will lead to a healthier nation.

While antagonism over the safety of cloned animal products has incessantly been questioned, majority of the people have began viewing cloning as one of the feasible ways of creating means of feeding a world whose population is constantly on the rise (North Carolina Association for Biomedical Research 2).

Cloning presents a way of ensuring that the precise quality of food can be harvested over and over. In light of the recent financial crises and the increased food insecurity issues especially in developing counties, such moves that promise adequate food supplies are welcome.

This study set out on a quest to state if the banning of cloning research efforts was justifiable. Considering the numerous benefits that further research would have presented, I would view this ban as grossly unjustifiable. Should the ban on funding of cloning projects not have been made, one can only guess at the numerous groundbreaking achievements that could have been made by now.

The novel ideal of individual organ cloning would have alleviated the present problem that is so prevalent in the health care system. In addition, the global food crisis would be significantly averted among other benefits.

Kfoury, Charlotte. “Therapeutic cloning: promises and issues.” MJM , 10.2 2007:112-120. Print.

Lanza, Robert. “After Dolly: the use and misuse of human cloning (BOOK REVIEW).” The journal of clinical investigation, 117.2 2007: 283. Print.

Mollard, Richard. Reproductive cloning . 2005. Web.

North Carolina Association for Biomedical Research. Cloning . 2006. Web.

Pearson, Yvette. “Never Let Me Clone? Countering an Ethical Argument against the Reproductive Cloning of Humans.” European Molecular Biology Organization , 7.7 2006: 657-59. Print.

Wolfe, John. “Gene Therapy in Large Animal Models of Human Genetic Diseases.” ILAR J , 50.2 2009: 107-111. Print.

• Biometric Technologies and Security
• The Rationale of the Cryonics
• The New Advancements in Cloning and the Ethical Debate Surrounding It
• Ethical Issues on Human Therapeutic and Reproductive Cloning
• Controversies in Therapeutic Cloning
• Electronic Range Finder Technology Application
• The differences between e-readers and tablets
• Moral and Ethical Issues in Science and Technology
• Security of information in law enforcement and national security organizations
• High Strength Super Alloys, Fundamentals Science and Engineering Applications
• Chicago (A-D)
• Chicago (N-B)

IvyPanda. (2018, July 19). The Cloning Controversy. https://ivypanda.com/essays/cloning/

"The Cloning Controversy." IvyPanda , 19 July 2018, ivypanda.com/essays/cloning/.

IvyPanda . (2018) 'The Cloning Controversy'. 19 July.

IvyPanda . 2018. "The Cloning Controversy." July 19, 2018. https://ivypanda.com/essays/cloning/.

1. IvyPanda . "The Cloning Controversy." July 19, 2018. https://ivypanda.com/essays/cloning/.

Bibliography

IvyPanda . "The Cloning Controversy." July 19, 2018. https://ivypanda.com/essays/cloning/.

IvyPanda uses cookies and similar technologies to enhance your experience, enabling functionalities such as:

• Basic site functions
• Ensuring secure, safe transactions
• Secure account login
• Remembering account, browser, and regional preferences
• Remembering privacy and security settings
• Analyzing site traffic and usage
• Personalized search, content, and recommendations
• Displaying relevant, targeted ads on and off IvyPanda

Please refer to IvyPanda's Cookies Policy and Privacy Policy for detailed information.

Certain technologies we use are essential for critical functions such as security and site integrity, account authentication, security and privacy preferences, internal site usage and maintenance data, and ensuring the site operates correctly for browsing and transactions.

Cookies and similar technologies are used to enhance your experience by:

• Remembering general and regional preferences
• Personalizing content, search, recommendations, and offers

Some functions, such as personalized recommendations, account preferences, or localization, may not work correctly without these technologies. For more details, please refer to IvyPanda's Cookies Policy .

To enable personalized advertising (such as interest-based ads), we may share your data with our marketing and advertising partners using cookies and other technologies. These partners may have their own information collected about you. Turning off the personalized advertising setting won't stop you from seeing IvyPanda ads, but it may make the ads you see less relevant or more repetitive.

Personalized advertising may be considered a "sale" or "sharing" of the information under California and other state privacy laws, and you may have the right to opt out. Turning off personalized advertising allows you to exercise your right to opt out. Learn more in IvyPanda's Cookies Policy and Privacy Policy .

• IELTS Scores
• Life Skills Test
• Find a Test Centre
• Alternatives to IELTS
• All Lessons
• General Training
• IELTS Tests
• Academic Word List
• Topic Vocabulary
• Collocation
• Phrasal Verbs
• Writing eBooks
• Reading eBook
• All eBooks & Courses
• Sample Essays
• Human Cloning Essay

IELTS Human Cloning Essay

This is a model answer for a  human cloning  essay.

If you look at the task, the wording is slightly different from the common  'do you agree or disagree'  essay.

However, it is essentially asking the same thing.

As people live longer and longer, the idea of cloning human beings in order to provide spare parts is becoming a reality. The idea horrifies most people, yet it is no longer mere science fiction.

To what extent do you agree with such a procedure?

Have you any reservations?

Understanding the Question and Task

You are asked if you agree with human cloning to use their body parts (in other words, what are the benefits), and what reservations (concerns) you have (in other words, what are the disadvantages).

So the best way to answer this human cloning essay is probably to look at both sides of the issue as has been done in the model answer.

As always, you must read the question carefully to make sure you answer it fully and do not go off topic.

You are specifically being asked to discuss the issue of creating human clones to then use their body parts. If you write about other issues to do with human cloning, you may go off topic.

Model Human Cloning Essay

You should spend about 40 minutes on this task.

Write about the following topic:

Give reasons for your answer and include any relevant examples from your own experience or knowledge.

Write at least 250 words.

Model Answer for Human Cloning Essay

The cloning of animals has been occurring for a number of years now, and this has now opened up the possibility of cloning humans too. Although there are clear benefits to humankind of cloning to provide spare body parts, I believe it raises a number of worrying ethical issues.

Due to breakthroughs in medical science and improved diets, people are living much longer than in the past. This, though, has brought with it problems. As people age, their organs can fail so they need replacing. If humans were cloned, their organs could then be used to replace those of sick people. It is currently the case that there are often not enough organ donors around to fulfil this need, so cloning humans would overcome the issue as there would then be a ready supply.

However, for good reasons, many people view this as a worrying development. Firstly, there are religious arguments against it. It would involve creating other human beings and then eventually killing them in order to use their organs, which it could be argued is murder. This is obviously a sin according to religious texts. Also, dilemmas would arise over what rights these people have, as surely they would be humans just like the rest of us. Furthermore, if we have the ability to clone humans, it has to be questioned where this cloning will end. Is it then acceptable for people to start cloning relatives or family members who have died?

To conclude, I do not agree with this procedure due to the ethical issues and dilemmas it would create. Cloning animals has been a positive development, but this is where it should end.

(276 words)

The essay is well-organized, with a clear introducion which introduces the topic:

• The cloning of animals has been occurring for a number of years now, and this has now opened up the possibility of cloning humans too.

And it has a thesis statement that makes it clear exactly how the human cloning essay will be structured and what the candidate's opinion is:

• Although there are clear benefits to humankind of cloning to provide spare body parts, I believe it raises a number of worrying ethical issues.

The first body paragraph discusses the advantages of cloning humans, and then the second body paragraph looks at the problems associated with this. The change of direction to look at the other side is clearly marked with a transition word ("however") and a topic sentence:

• However, for good reasons, many people view this as a worrying development.

Other transition words are used effectively to guide the reader through the ideas in the human cloning essay: Firstly,.. Also,... Furthermore,...

The candidate demonstrates that they can use a mix of complex structures. For example:

• Due to breakthroughs in medical science and improved diets, people are living much longer than in the past.
• It would involve creating another human and then eventually killing it in order to use its organs, which it could be argued is murder.
• ...if we have the ability to clone humans, it has to be questioned where this cloning will end.

<<< Back

Next >>>

More Agree / Disagree Essays:

Multinational Organisations and Culture Essay

Multinational Organisations and Culture Essay: Improve you score for IELTS Essay writing by studying model essays. This Essay is about the extent to which working for a multinational organisation help you to understand other cultures.

Scientific Research Essay: Who should be responsible for its funding?

Scientific research essay model answer for Task 2 of the test. For this essay, you need to discuss whether the funding and controlling of scientific research should be the responsibility of the government or private organizations.

Internet vs Newspaper Essay: Which will be the best source of news?

A recent topic to write about in the IELTS exam was an Internet vs Newspaper Essay. The question was: Although more and more people read news on the internet, newspapers will remain the most important source of news. To what extent do you agree or disagree?

Technology Development Essay: Are earlier developments the best?

This technology development essay shows you a complex IELTS essay question that is easily misunderstood. There are tips on how to approach IELTS essay questions

IELTS Internet Essay: Is the internet damaging social interaction?

Internet Essay for IELTS on the topic of the Internet and social interaction. Included is a model answer. The IELTS test usually focuses on topical issues. You have to discuss if you think that the Internet is damaging social interaction.

Employing Older People Essay: Is the modern workplace suitable?

Employing Older People Essay. Examine model essays for IELTS Task 2 to improve your score. This essay tackles the issue of whether it it better for employers to hire younger staff rather than those who are older.

Role of Schools Essay: How should schools help children develop?

This role of schools essay for IELTS is an agree disagree type essay where you have to discuss how schools should help children to develop.

Free University Education Essay: Should it be paid for or free?

Free university education Model IELTS essay. Learn how to write high-scoring IELTS essays. The issue of free university education is an essay topic that comes up in the IELTS test. This essay therefore provides you with some of the key arguments about this topic.

Airline Tax Essay: Would taxing air travel reduce pollution?

Airline Tax Essay for IELTS. Practice an agree and disagree essay on the topic of taxing airlines to reduce low-cost air traffic. You are asked to decide if you agree or disagree with taxing airlines in order to reduce the problems caused.

Truthfulness in Relationships Essay: How important is it?

This truthfulness in relationships essay for IELTS is an agree / disagree type essay. You need to decide if it's the most important factor.

Ban Smoking in Public Places Essay: Should the government ban it?

Ban smoking in public places essay: The sample answer shows you how you can present the opposing argument first, that is not your opinion, and then present your opinion in the following paragraph.

Extinction of Animals Essay: Should we prevent this from happening?

In this extinction of animals essay for IELTS you have to decide whether you think humans should do what they can to prevent the extinction of animal species.

IELTS Vegetarianism Essay: Should we all be vegetarian to be healthy?

Vegetarianism Essay for IELTS: In this vegetarianism essay, the candidate disagrees with the statement, and is thus arguing that everyone does not need to be a vegetarian.

Dying Languages Essay: Is a world with fewer languages a good thing?

Dying languages essays have appeared in IELTS on several occasions, an issue related to the spread of globalisation. Check out a sample question and model answer.

Paying Taxes Essay: Should people keep all the money they earn?

Paying Taxes Essay: Read model essays to help you improve your IELTS Writing Score for Task 2. In this essay you have to decide whether you agree or disagree with the opinion that everyone should be able to keep their money rather than paying money to the government.

Examinations Essay: Formal Examinations or Continual Assessment?

Examinations Essay: This IELTS model essay deals with the issue of whether it is better to have formal examinations to assess student’s performance or continual assessment during term time such as course work and projects.

Return of Historical Objects and Artefacts Essay

This essay discusses the topic of returning historical objects and artefacts to their country of origin. It's an agree/disagree type IELTS question.

Essay for IELTS: Are some advertising methods unethical?

This is an agree / disagree type question. Your options are: 1. Agree 100% 2. Disagree 100% 3. Partly agree. In the answer below, the writer agrees 100% with the opinion. There is an analysis of the answer.

Sample IELTS Writing: Is spending on the Arts a waste of money?

Sample IELTS Writing: A common topic in IELTS is whether you think it is a good idea for government money to be spent on the arts. i.e. the visual arts, literary and the performing arts, or whether it should be spent elsewhere, usually on other public services.

IELTS Sample Essay: Is alternative medicine ineffective & dangerous?

IELTS sample essay about alternative and conventional medicine - this shows you how to present a well-balanced argument. When you are asked whether you agree (or disagree), you can look at both sides of the argument if you want.

Any comments or questions about this page or about IELTS? Post them here. Your email will not be published or shared.

Band 7+ eBooks

"I think these eBooks are FANTASTIC!!! I know that's not academic language, but it's the truth!"

Linda, from Italy, Scored Band 7.5

Bargain eBook Deal! 30% Discount

All 4 Writing eBooks for just  $25.86 Find out more >>

IELTS Modules:

Other resources:.

• Band Score Calculator
• Writing Feedback
• Speaking Feedback
• Teacher Resources
• Free Downloads
• Recent Essay Exam Questions
• Books for IELTS Prep
• Useful Links

Recent Articles

Selling a Mobile Phone to a Friend

Sep 15, 24 02:20 AM

Tips and Technique for IELTS Speaking Part 1

Sep 14, 24 02:41 AM

Grammar in IELTS Listening

Aug 22, 24 02:54 PM

Important pages

IELTS Writing IELTS Speaking IELTS Listening   IELTS Reading All Lessons Vocabulary Academic Task 1 Academic Task 2 Practice Tests

Connect with us

Before you go...

30% discount - just $25.86 for all 4 writing ebooks.

Copyright © 2022- IELTSbuddy All Rights Reserved

IELTS is a registered trademark of University of Cambridge, the British Council, and IDP Education Australia. This site and its owners are not affiliated, approved or endorsed by the University of Cambridge ESOL, the British Council, and IDP Education Australia.

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here .

Loading metrics

Open Access

Peer-reviewed

Research Article

MultiGreen: A multiplexing architecture for GreenGate cloning

Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing

* E-mail: [email protected]

Affiliation Institute of Plant Breeding, Genetics and Genomics, University of Georgia, University of Georgia, Athens, Georgia, United States of America

Roles Conceptualization, Supervision, Writing – review & editing

Affiliation Center for Applied Genetic Technologies, University of Georgia, Athens, Georgia, United States of America

Roles Funding acquisition, Project administration, Supervision, Writing – review & editing

Affiliations Institute of Plant Breeding, Genetics and Genomics, University of Georgia, University of Georgia, Athens, Georgia, United States of America, Center for Applied Genetic Technologies, University of Georgia, Athens, Georgia, United States of America, Department of Crop and Soil Sciences, University of Georgia, Athens, Georgia, United States of America

• Vincent J. Pennetti, 
• Peter R. LaFayette, 
• Wayne Allen Parrott

• Published: September 18, 2024
• https://doi.org/10.1371/journal.pone.0306008
• Reader Comments

Genetic modification of plants fundamentally relies upon customized vector designs. The ever-increasing complexity of transgenic constructs has led to increased adoption of modular cloning systems for their ease of use, cost effectiveness, and rapid prototyping. GreenGate is a modular cloning system catered specifically to designing bespoke, single transcriptional unit vectors for plant transformation—which is also its greatest flaw. MultiGreen seeks to address GreenGate’s limitations while maintaining the syntax of the original GreenGate kit. The primary limitations MultiGreen addresses are 1) multiplexing in series, 2) multiplexing in parallel, and 3) repeated cycling of transcriptional unit assembly through binary intermediates. MultiGreen efficiently concatenates bespoke transcriptional units using an additional suite of level 1acceptor vectors which serve as an assembly point for individual transcriptional units prior to final, level 2, condensation of multiple transcriptional units. Assembly with MultiGreen level 1 vectors scales at a maximal rate of 2*⌈ log 6 n ⌉+3 days per assembly, where n represents the number of transcriptional units. Further, MultiGreen level 1 acceptor vectors are binary vectors and can be used directly for plant transformation to further maximize prototyping speed. MultiGreen is a 1:1 expansion of the original GreenGate architecture’s grammar and has been demonstrated to efficiently assemble plasmids with multiple transcriptional units. MultiGreen has been validated by using a truncated violacein operon from Chromobacterium violaceum in bacteria and by deconstructing the RUBY reporter for in planta functional validation. MultiGreen currently supports many of our in-house multi transcriptional unit assemblies and will be a valuable strategy for more complex cloning projects.

Citation: Pennetti VJ, LaFayette PR, Parrott WA (2024) MultiGreen: A multiplexing architecture for GreenGate cloning. PLoS ONE 19(9): e0306008. https://doi.org/10.1371/journal.pone.0306008

Editor: Mohammad Irfan, Cornell University, UNITED STATES OF AMERICA

Received: June 8, 2024; Accepted: August 30, 2024; Published: September 18, 2024

Copyright: © 2024 Pennetti et al. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting information files.

Funding: “Funding was provided by the U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research program under Award number DE-SC0023338 and DE-AC05-00OR22725 through the Center for Bioenergy Innovation. The funders had no role in study design, data collection and analysis, or preparation of the manuscript.”

Competing interests: The authors have declared that no competing interests exist.

Introduction

Simple made-to-order gene expression units met research and commercial requirements for the first few decades of transformation technology. These expression units were assembled with traditional cut-and-paste-style molecular cloning [ 1 ]. In principle, the only requirements are a backbone with a multiple cloning site, access to compatible restriction enzymes for the insert, the consumables for PCR and restriction ligation, and the result is a transcriptional unit with a minimum of four components: the promoter and 5’ UTR, coding sequence, terminator and 3’ UTR, and vector backbone [ 2 ].

Current needs increasingly require multiplexed guides for editing, or multiple enzymes for metabolic engineering or trait-stacking. While cut-and-paste cloning is efficient and largely the basis for many modern cloning strategies, its utility decreases as the number of transcriptional units to be assembled increases. A more streamlined approach to plasmid construction is the reliance on standardized components and the use of modular assembly.

Gateway cloning is one of the earliest methods for modular assembly and employs site-specific recombination for plasmid construction [ 3 ]. Gateway cloning was commercialized by Invitrogen in the 1990s and relies upon recombinase enzymes from phage λ that can recombine DNA sequences flanked by Gateway recombination sites in a series of reactions—the BP and LR reactions recombining between attB - attP and attL-attR sites, respectively. Additional improvements led to MultiSite Gateway cloning, with which two to four DNA fragments can be combined in a single vector using the BP and LR Clonase enzymes [ 4 ]. Besides cost, Gateway recombination leaves recombination sites in the final assembly, called scars, that can add 8 to 13 additional amino acids to final reading frames [ 5 ].

A more modern approach to modularity is Golden Gate cloning [ 5 ]. Golden Gate cloning, which uses one step, one pot, rapid assembly, was proposed initially to address the major limitations of Gateway cloning. It relies on Type IIS restriction enzymes that cleave double-stranded DNA outside of their recognition sequence, leaving behind a minimal overhang. By deploying diverse Type IIS sticky overhangs, multiple DNA fragments can be combined unidirectionally in a one-pot reaction using only one restriction enzyme. As many as 52 parts have been assembled in a one-pot reaction with Golden Gate cloning, with approximately 50% efficiency [ 6 ].

There are several different Golden Gate cloning systems available that rely on Type IIS restriction enzymes, i.e., Aar I/ Paq CI, Eco 31I/ Bsa I, and Bsm BI/ Esp 3I, such as GoldenBraid [ 7 ], Mobius Assembly [ 8 ], GreenGate [ 9 ], and MoClo [ 10 ], Each of these systems provides varying leverage over the components necessary for gene expression and approach modularity in a similar fashion, with unique grammar. The grammar of each system is determined by four factors 1) the Type IIS enzymes being used, 2) the coordinated overhangs left behind after Type IIS enzyme digestion for directional assembly, 3) the number of units into which individual transcripts are split into for modularity and 4) organization of the different stages of assembly—such as in parallel, in series, or a combination of the two.

Modern modular assembly systems must fulfill two tasks. The first is assembling promoters, coding sequences, and other components into transcriptional units. Second, the resulting transcriptional units must be assembled into a single multigene vector. Hence, each modular cloning system typically relies on multiple stages of assembly.

The initial stage produces “base,” “entry,” or “level 0” plasmids, each of which contains one component for gene expression, such as a promoter, flanked by Type IIS restriction sites. Subsequent one-pot reactions enable freeing of the components and unidirectional production of individual transcriptional units in another plasmid. Initial assemblies of “level 0” parts are often referred to as “level 1” assemblies and are composed of individual transcriptional units. Level 1 assemblies can be joined together with other level 1 assemblies into a final, “level 2” assembly composed of multiple transcriptional units [ 7 , 8 , 10 ]. Alternatively, level 1 assemblies can be iteratively combined for multiplexing before a final level 2 condensation.

Current modular cloning systems vary in complexity, the exact composition of overhangs, and the Type IIS enzyme responsible for freeing components. Except for GreenGate, all employ multiple Type IIS restriction enzymes to produce a final assembly. While using multiple enzymes can increase the burden of domestication, or the deactivation of naturally occurring Type IIS sites within parts, it enables efficient condensation of multiple transcriptional units either sequentially, or even by “braiding” of assemblies together in a cyclical fashion as in GoldenBraid [ 7 ].

GreenGate strikes a balance between ease of use and modularity, enabling control over all the key elements of a cassette for plant expression: promoter, N-tag peptide, coding sequence, C-tag, terminator, and plant selectable marker. Each of these modules are flanked by Bsa I sites, leaving seven, unique 4 base pair overhangs for unidirectional assembly—named the A, B, C, D, E, F, and G overhangs. The eighth, optional, H overhang can be introduced through a methylated oligoduplex for multiplexing and is the biggest pitfall of the GreenGate kit.

Therefore, we propose MultiGreen as a multiplexing solution, inspired by the original architecture set forth by GreenGate, to enable intuitive multiplexing while using only the syntax laid forth in the original GreenGate kit. MultiGreen is composed of two approaches to multiplexing: MultiGreen 1.0—assembly in series, and MultiGreen 2.0 assembly in parallel. Multiplexed assembly with MultiGreen is accomplished via a suite of additional vectors that enable condensation of multiple transcriptional units into one final plasmid. Both MultiGreen 1.0 and 2.0 can be combined for more complicated assemblies, or to insert transcriptional blockers [ 11 ] between transcriptional units without deviation from the original kit’s grammar. MultiGreen also encompasses a suite of linker modules that bridge gaps in parallel designs that don’t occupy all the conventional GreenGate overhangs, enabling assembly when some level 0 modules are absent. The suite of MultiGreen plasmids are available through Addgene.

General molecular biology reagents and methods

All consumable enzymes for restriction ligation and Gibson assembly were procured from NEB (New England Biolabs, Ipswich, MA) including Bsa I-HF-v2 (NEB #R3733S), Esp 3I (NEB #R0734S), NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621S), NEBridge Ligase Master Mix (NEB # M1100S), and cloning strains of E . coli , including DH5α (NEB #C2987H) and 10-beta (NEB # C3019H). For vectors containing the ccd B/CmR cassette, One Shot ccd B Survival cells (ThermoFisher Scientific, Waltham, MA, #A10460) were used during plasmid propagation.

All plasmids were isolated using standard protocols and reagents from the GenCatch plasmid DNA mini-prep kit (Epoch Life Science, Missouri City, TX). Amplification of target sequences under 5 kb were produced using Q5 high fidelity polymerase (NEB # M0491S) under the recommended three-step amplification conditions, while amplicons over 5 kb were produced using PrimeStar GXL polymerase (Takara Bio, San Jose, CA, #R050A) in a two-step amplification reaction. All NEBuilder HiFi assemblies were executed following standard incubation [ 12 ] and transformation procedures [ 13 ] into their respective destination strains. All products of amplification were sequenced with either Sanger sequencing (Genewiz, South Plainfield, NJ) for regions <1600 bp, or Oxford Nanopore long-read sequencing (Plasmidsaurus, Eugene, OR) for regions >1600 bp.

Transformation of bacterial strains

Commercially available cloning strains of E . coli were used for transformation of all assemblies. The same protocol was used for all chemically competent strains used, adjusting the resuspension medium, outgrowth duration, and antibiotic selection for the strain and resistances being used. Two μL of assembly mix were combined with 10 μL of freshly thawed competent cells and incubated on ice for 30 mins in a 2-mL Eppendorf tube. The bacteria were then heat shocked at 42°C for 30s and immediately returned to ice for 5 minutes. Two hundred μL of resuspension medium (SOC for DH5α and OneShot cells; NEB 10-beta stable outgrowth medium for 10-beta cells) was added to the tubes. Plasmids selected on ampicillin were immediately plated on LB medium containing ampicillin while all other antibiotic selections were incubated in a 37°C shaking incubator for a 1-hr outgrowth. E . coli transformations were plated on LB supplemented with 15 g·L -1 BactoAgar and appropriate antibiotics for the plasmid being selected—100 μg·mL -1 ampicillin, 50 μg·mL -1 kanamycin, 25 μg·mL -1 chloramphenicol, 100 μg·mL -1 spectinomycin. Colonies were isolated for liquid culture and sequencing following overnight incubation at 37°C.

Level 0 entry vector construction

Level 0 entry vectors were created through a scaled down NEBuilder (NEB, Ipswich, MA) reaction. For single insert entry vectors, individual PCR amplicons were produced using Q5 high fidelity polymerase (NEB # M0491S) and isolated from a 0.5X TBE gel by centrifugation of a gel core through an EconoSpin column (Epoch Life Science, Missouri City, TX), at 10000 x g for three minutes. One μL of the eluate was immediately combined with 1 μL of Bsa I-HFv2-digested level 0 entry vector normalized to 50 ng·μL -1 and 1 μL of NEBuilder HiFi DNA Assembly Master Mix. Single-insert assemblies were incubated at 50°C for 20 minutes prior to transformation into chemically competent DH5α cells. A list of primers used for assemblies is in S1 Table .

Domestication of Esp 3I sites in level 0 inserts was addressed via site-directed mutagenesis with degenerate PCR primers. Briefly, overlapping primers for NEBuilder assembly were designed with a minimum of 15-bp-overlap spanning the restriction site to be domesticated. A single point mutation was introduced within the overlap to disable the site. If the domestication site was within a coding sequence, synonymous mutations were introduced. Following amplification of the two fragments spanning the site, the level 0 entry vector construction proceeded as described with NEBuilder. Components requiring multiple restriction site domestications per insert were incubated at 50°C for 1 hour prior to transformation, rather than 20 minutes. Further, 0.5 μL of NEBuilder HiFi DNA Assembly Master Mix was added for each additional insert.

As the default GreenGate entry vector plasmids contain two Esp 3I sites within 40 bp of each other in the backbone, we created a derivative suite of base level 0 entry vectors eliminating the Esp 3I sites. Domestication of these sites is not essential for successful MultiGreen assembly using pre-made level 0 entry vectors, as the overhangs resulting from Esp 3I digestion of the entry vector backbone are incompatible with the overhangs for GreenGate assembly. Initial attempts of single-stranded oligo assembly of the digested vector failed, so we combined inverse PCR with single-stranded oligo assembly to disable the two Esp 3I sites. The sequences 5’- AGACGAAAGGGCCTCGTGAT -3’ and 5’- AGACGGTCACAGCTTGTCTG -3’ were used as the forward and reverse primers, respectively, to amplify the entire entry vector using Q5 high fidelity polymerase. The amplicon was isolated as described for level 0 amplicons and combined with 1 μL of a 1:250 dilution of 100 μM single-stranded oligo for recircularization (5’- CAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGAT -3’). One μL of NEBuilder HiFi DNA Assembly Master Mix was then added, and the mix incubated for 1 hour at 50°C before transformation into E . coli strain DB3.1.

Level 0 entry clones for linker modules not requiring PCR were assembled via a sense/antisense single stranded oligo NEBuilder hybridization. Briefly, single-stranded oligos were designed to contain 20 bp of complementarity to their desired vector backbone, the required Type IIS recognition sequence and overhang, and 15–20 bp of complementarity to the 5’ oligo for hybridization. Then, 1:250 dilutions of 100 μM oligos (Millipore Sigma, Burlington, MA) were prepared with type I water. One μL each of the sense and antisense oligo dilutions were then combined with 1 μL of cut level 0 entry vector at 50 ng·μL -1 and 2 μL of NEBuilder HiFi DNA Assembly Master Mix. The reaction mix was then incubated at 50°C for 1 hour prior to transformation. A list of oligos used for producing linker modules can be found in S1 Table .

Level 1 MultiGreen intermediary vector construction

Level 1 MultiGreen intermediary vectors were made through successive PCR amplification and assembly using NEBuilder. Destination vector pGGP-AG [ 14 ] was domesticated of its three Esp 3I sites as described, generating pVP076, which was then used as the template in a second round of PCR amplification and NEBuilder assemblies to generate the initial suite of MultiGreen level 1 acceptor vectors.

Six sets of overlapping PCR primers were designed to include both homology to the backbone, pairs of flanking Esp 3I and Bsa I sites, GreenGate-compatible overhangs, and homology to the ccd B/chloramphenicol cassette to retain the counterselection used in all GreenGate base vectors. Plasmid VP076 was digested in a 10 μL digest using 1 μg of plasmid, 0.5 μL of Bsa I-HF-v2, and 1 μL of CutSmart Buffer (NEB #B6004S) for one hour at 37°C. Following incubation, 2 μL of loading dye were added, the digestion was run on a gel, and the backbone isolated as before. One μL each of PCR amplicon, backbone, and NEBuilder were assembled and transformed into OneShot ccd B survival cells as outlined above, generating pVP078, pVP079, pVP080, pVP081, pVP082, and pVP083 corresponding to MultiGreen level 1 acceptor vectors with final GreenGate-compatible AB, BC, CD, DE, EF, and FG overhangs, respectively.

To make another destination vector, and progenitor to a second suite of MultiGreen intermediary vectors, kanamycin resistance was introduced using restriction ligation of pGGP-AG and NEBuilder assembly with an amplified aph(3’)-Ia kanamycin resistance gene from p201NCas9 [ 15 ]. Destination vector pGGP-AG was digested as above, except with Ava II instead of Bsa I, ejecting a 641-bp fragment of the spectinomycin resistance gene from the vector. The kanamycin resistance gene was then amplified using 5’- CGTATGCGCTCACGCAACTGGATGAGCCATATTCAACGG -3’ as the forward primer and 5’- AAAGAGTTCCTCCGCCGCTGTTAGAAAAACTCATCGAGC -3’ as the reverse primer, sharing a 20-bp overlap with the cut vector, and maintaining the reading frame established by the remaining 5’ end of the spectinomycin resistance gene. The NEBuilder assembly was performed and transformed into OneShot ccd B survival cells, and selected on LB kanamycin for successful assembly, generating pGGPK-AG2.

The Esp 3I sites of pGGPK-AG2 were domesticated as in pVP076, with an additional pair of overlapping degenerate primers for the Esp 3I site within the kanamycin resistance gene to generate pVP077. Plasmid VP077 was subsequently used for its kanamycin-resistant and Esp 3I-domesticated backbone to generate a second suite of MultiGreen level 1 acceptor vectors, pVP311, pVP312, pVP313, pVP314, pVP315, pVP316, following the same steps and amplifications as with pPV078-pVP083. pVP076 was also digested and assembled via NEBuilder with a PCR amplicon containing mRFP1E chromoprotein (Addgene #160442) in place of ccd B/CmR, generating pVP096.

Level 1 and Level 2 GreenGate assembly with NEBridge

Level 1 and level 2 assemblies were performed using NEBridge ligase master mix described previously unless otherwise noted [ 16 ]. Level 1 assemblies with solely GreenGate level 0 entry vectors require only Bsa I as the restriction enzyme. Assemblies using previously made MultiGreen level 1 assemblies also required Esp 3I in the reaction cocktail to facilitate freeing of level 1 modules. Recurrent level 1 and level 2 assemblies were performed in a one-pot reaction with a total volume of 15 μL. Each overhang in the assembly was be used, either directly through the compatible level 0 module or level 1 assembly, or indirectly via a MultiGreen linker module spanning the unused overhangs.

MultiGreen cloning validation through protoviolaceinate biosynthesis

To ensure MultiGreen functioned as envisioned, protoviolaceinate biosynthesis from Chromobacterium violaceum was reconstructed as a four transcriptional unit stack using MultiGreen 2.0. Level 0 components were produced as outlined above and as listed in S2 Table . Initial attempts at level 1 assemblies sought to combine each violacein gene with the strongest in house characterized promoter pGG-A-PJ23119:PGLPT-C/pVP217, pGG-D-rrnbT1-F/pVP223 terminator into spectinomycin resistant MultiGreen 2.0 intermediary vectors AB/pVP078, BC/pVP079, DE/pVP081, and EF/pVP082, respectively. In addition, eGFP was assembled with the strongest characterized promoter into a spectinomycin resistant MultiGreen 2.0 intermediary FG/pVP083.

Plasmid MG2.0-B-PJ23119:PGLPT:vioB:rrnb1-C/pVP268, pMG2.0-E-PJ23119:PGLPT:vioE:rrnb1-F/pVP271, and pMG2.0-F-PJ23119:PGLPT:gfp:rrnb1-G/pVP272 were successfully cloned. Plasmid MG2.0-A-PJ23119:PGLPT:vioA:rrnb1-B/pVP267 and pMG2.0-D-PJ23119:PGLPT:vioD:rrnb1-E/pVP270, however, failed to be isolated after repeated assembly attempts.

Given the failed assembly of vioA and vioD , weaker promoter variants of each vioA— pMG2.0-A-PJ23100:B0030:vioA:rrnb1-B/pVP250, and vioD —pMG2.0-D-PJ23100:B0030:vioD:rrnb1-E/pVP253 were cloned. The weakly expressing vioA and vioD were then combined with the strongly expressing vioB and vioC , pGG-bd-C-dummy-D /pVP293, pMG2.0-F-PJ23119:PGLPT:gfp:rrnb1-G/pVP272, and kanamycin-resistant pVP096 in a level 2 MultiGreen assembly to produce pVP290—expressing all four genes necessary for protoviolaceinate biosynthesis in E . coli . pVP250 is a very low-yielding plasmid (50–60 ng·μL -1 ). Therefore, the NEBridge assembly was performed as outlined above using only 0.02 pmol of each input component.

Three biological replicates of the MultiGreen 2.0 assemblies were constructed and transformed on independent days into NEB 10-beta chemically competent cells. Three serial dilutions of the bacterial culture were plated on LB kanamycin plates and incubated for 40 hours prior to imaging to allow for pigment production. Serial dilutions with discernable colony separation were used for imaging and assembly efficiency quantification. Undigested destination vector carryover (pVP096) was scored for fluorescence of the mRFP1E visual reporter situated between assembly sites. Three random colonies failing to express both the protoviolaceinate pigment and the mRFP1e reporter were sent for whole plasmid sequencing via Plasmidsaurus to evaluate assembly fidelity. Colony counts were tallied, and efficiency calculated in Microsoft Excel for Mac version 16.81 (Microsoft Corporation, Redmond, WA).

Deconstructed RUBY Nicotiana benthamiana assay

To further test MultiGreen in a eukaryotic system, the enzymes of the RUBY reporter [ 17 ] were reassembled using separate MultiGreen 2.0 level 1 assemblies for each transcriptional unit. Level 1 assemblies were performed with NEBridge Ligase Master Mix using the following level 0 components: pGG-A-GmUbi3L-B containing the GmUbi3L promoter from Glycine max [ 18 ], pGGB003 [ 9 ], pGG-C-CYP76AD1-D/pVP214 and pGG-C-DODA-D/pVP215 and pGG-C-GT-D/pVP216 modules corresponding to each coding sequence in the RUBY reporter [ 17 ], pGGD002 [ 9 ], pGG-E-StPinII-F containing the PinII terminator from Solanum tuberosum [ 19 ], pGG-F-dummy-G. CYP76AD1, DODA, and GT were assembled into the spectinomycin-resistant MultiGreen2.0 AB/pVP078, BC/pVP079, and CD/pVP080 intermediaries, respectively. Correct clones were then used in a level 2 MultiGreen assembly using NEBridge Ligase master mix with pGG-C-dummy-D/pVP121 linker into the kanamycin-resistant pVP096 domesticated destination vector.

Competent cells of an in-house disarmed thyA - recA - variant of Agrobacterium rhizogenes strain K599 (aka NCPPB2659) [ 20 ] were prepared as specified in the BioRad MicroPulser ™ (Biorad Laboratories, Hercules CA, US) manual. Cells were recovered in liquid YP medium [ 21 ] containing 150 mg·L -1 thymidine and no antibiotics for 4 h at 28°C with shaking. After recovery, the bacterial suspension was plated onto solid YP medium containing 150 mg·L -1 thymidine and 50 mg·L -1 kanamycin. Single kanamycin-resistant colonies growing on the electroporation plate were inoculated into 25 mL liquid YP cultures for overnight incubation at 28°C with shaking. Agrobacterium suspensions and Nicotiana benthamiana infiltrations were conducted as described previously [ 11 ], only deviating by addition of thymidine to all media containing Agrobacterium . The three youngest, expanded leaves were infiltrated with bacterial suspension of OD600 of 0, 0.1, 0.2, 0.5, and 1.0.

Three days after infiltration, betanin production was quantified based on previously outlined experimental procedures [ 22 ]. Individual 8-mm leaf discs were collected using disposable biopsy punches, one leaf per infiltration site, three leaves per plant, and added to 2-mL Eppendorf tubes containing 2 mL of 100% ethanol for chlorophyll bleaching for a minimum of 24 h. Following bleaching, leaf discs were individually removed, rinsed with fresh 100% ethanol, and added to a 96-well plate (VWR, Radnor, PA, # 10861–562) containing 150 μL of type I water per well. The 96-well plates were allowed to incubate on the bench top for 24 hours, upon which leaf discs were removed and absorbance at 538 nm was measured on a Biotek Synergy2 plate reader (BioTek Instruments Inc., Winooski, VT, USA). Absorbance readings were imported to GraphPad Prism 10 for macOS version 10.2.0 for plotting and analysis.

Results and discussion

Multigreen 1.0—multiplexing in series.

The original GreenGate cloning kit is composed of a suite of entry modules containing convergent pairs of Bsa I sites flanking components of interest for one-pot assembly [ 9 ]. For Golden Gate assembly reactions, it is important to domesticate, i.e., remove all the unnecessary restriction sites for the Type IIS enzyme used for assembly to avoid unintended mis-assemblies. Fortunately, many of the Type IIS restriction enzymes have recognition sequences >5 bp, reducing their frequency of occurrence.

Often, fragments for Golden Gate assemblies are plasmids containing Type IIS sites flanking the insert, or PCR amplicons with compatible cut sites within or near the amplification primers. If plasmids are used as the DNA source, it is common to use alternating antibiotic selections between the parent and child vectors to circumvent carryover, or persistence, of the parent plasmid in subsequent reactions [ 7 , 9 , 10 , 23 ].

The canonical entry vectors for GreenGate cloning include A, B, C, D, E, F, and G overhangs in ampicillin-resistant level 0 plasmids to enable unidirectional assembly ( Fig 1A ). Multiplexing as proposed with the original GreenGate kit introduces the optional H overhang via methylated oligos and linker modules between F and G, thereby multiplexing in series from a 5’ → 3’ direction. For duplex assemblies with GreenGate, one additional overhang can be introduced with a specifically methylated oligoduplex, such that the first transcriptional unit assembled becomes the destination vector for the second transcriptional unit by exploiting the methylation sensitivity of Bsa I, effectively blocking digestion of the hidden overhangs in the first iteration of cloning [ 9 ]. Multiplexing via the methylated oligoduplex strategy is not only cost-prohibitive, but results in a heightened screening burden, as there is no intrinsic counterselection between assemblies.

• PPT PowerPoint slide
• PNG larger image
• TIFF original image

A) Schematic overview of a standard GreenGate reaction condensing six entry vectors, AB Promoter, BC N-tag, CD GOI, DE C-tag, EF terminator, FG resistance, into a destination vector using a one-pot Bsa I mediated restriction ligation reaction. B) MultiGreen 1.0 expansion modules introduce the H overhang as a split of two new Level 0 entry vectors, the FH module is reserved for transcription blockers and the HG module is reserved for the multiplexer. The HG multiplexer module contains a pair of Esp 3I sites internal to the Bsa I sites for conventional GreenGate assembly, but external to the chromoprotein reporter. Each assembly that incorporates the level 0 HG and FH modules for multiplexing can be visually selected for integration of the multiplexer module. Subsequent MultiGreen 1.0 reactions should alternate visual reporters to efficiently screen one assembly round from the next as the chemical selection is set by the initial destination vector. The assembly for the final transcriptional unit should either include the FH transcription blocker and HG filler modules to terminate the multiplexing, or alternatively a level 0 FG plant selectable marker module can be included. C) Detailed view of how the multiplexer operates by incorporating an external set of Esp 3I sites flanking a visual reporter. Inclusion of the FH and HG modules in lieu of the FG followed by selection for colonies expressing the visual reporter enables iterative stacking in series.

https://doi.org/10.1371/journal.pone.0306008.g001

As an alternative, MultiGreen 1.0 introduces the additional H overhang via two new Level 0 entry vectors, the FH and HG modules ( Fig 1B ). This approach is possible by incorporating a second Type IIS restriction enzyme, Esp 3I. Therefore, all components in an assembly must be domesticated for Esp 3I or adequately screened for correct assembly from one reaction to the next. Domestication of existing components can be readily performed by inverse PCR with degenerate primers destroying the undesired cut site followed by restriction-ligation or Gibson assembly. Alternatively, single-stranded oligos have been successfully used in conjunction with digested vectors in a Gibson assembly reaction for site domestication in an oligo-stitching reaction [ 24 ].

Like Bsa I, Esp 3I is has a 6-base pair recognition sequence, leaving a 4-base pair sticky overhang. The MultiGreen 1.0 FH module is reserved for a transcription blocker, or alternatively can contain a spacer sequence ( Fig 1B ). We preconfigured several HG multiplexer modules with visually distinct chromoprotein reporters including meffBlue [ 25 ], mRFP1e [ 26 ], and spisPink [ 25 ]. With each iteration of multiplexing, correctly assembled clones possessing the multiplexer module for the next round of assembly can be selected for expression of the respective chromoprotein reporter. The availably of multiple reporters enables recurrent passage of assemblies through visual screening for the reporter included in each assembly step. The chromoproteins that come with MultiGreen 1.0 can be swapped for other reporters, or even antibiotic resistance genes by performing a standard PCR and either restriction-ligation or Gibson assembly.

The chromoproteins within the HG multiplexer were amplified directly from Addgene bacterial expression plasmids. The chromoproteins in the HG multiplexer modules are flanked by convergent Bsa I sites, enabling assembly alongside other level 0 entry vectors, as is the case in a conventional GreenGate reaction. Just internal to the Bsa I sites, but still external to the chromoprotein, are a pair of divergent Esp 3I sites. These remain undigested in the initial assembly, as Bsa I is the only restriction enzyme present, effectively providing a future pair of compatible A-G destination overhangs in a subsequent reaction with Esp 3I ( Fig 1C ). A correct clone expressing the chromoprotein can then be used as the destination vector for a subsequent assembly by digestion with Esp 3I, freeing the receptive destination A-G overhangs for another transcriptional unit assembly.

MultiGreen 1.0’s time for assembly scales at an approximate rate of 2n +1 days, where n is the number of transcriptional units, and assumes all level 0 components and reagents are available when assembly is started, and that diagnostic screens occur the same day colonies appear. This rate of assembly is tolerable for simple assemblies but draws out when additional transcriptional units are desired. A unique advantage of MultiGreen 1.0 is that if there is a gene cassette containing Esp 3I sites that cannot be easily domesticated, such as in regulatory sequences that may need additional validation after domestication, assembly can be structured such that the non- Esp 3I domesticated components are in the final reaction, where only Bsa I is the active restriction enzyme.

MultiGreen 2.0—Multiplexing in parallel

While MultiGreen 1.0 enabled efficient transcriptional unit stacking following the GreenGate multiplexing grammar, its efficiency of assembly lags for constructs with many transcriptional units. For example, assembling six cassettes with MultiGreen 1.0 would require a minimum of 13 days of cloning to produce the one final vector. Additionally, since MultiGreen 1.0 is multiplexing in series, and each successive reaction becomes the destination vector of the next, if it is desirable to exchange an individual transcriptional unit after assembly, it would be necessary to revert to the assembly just before the unwanted unit and restart incorporating the remaining transcriptional unit. To circumvent the limitations of overall time efficiency of assembly, maximize the compatibility of level 1 assemblies across constructs, and maintain compatibility with the original GreenGate syntax, we propose MultiGreen 2.0 –multiplexing in parallel ( Fig 2 ).

A schematic overview of multiplexing in parallel with MultiGreen 2.0. MultiGreen 2.0 uses a suite of level 1 acceptor vectors to produce initial concatenations of entry vectors. The level 1 acceptor vectors are not ampicillin resistant, allowing for chemical counterselection from level 0 entry vectors. Level 1 acceptor vectors are binary vectors themselves and can be used directly in Agrobacterium for (co)infection. Up to 6 Level 1 assemblies can be combined per reaction. By alternating selection choice of level 1 acceptor vectors, assemblies can be iteratively combined in multiples of 6. Note that alternating selection of level 1 acceptor vectors is only necessary for assemblies with >6 transcriptional units. Conventional GreenGate level 0 entry modules can be incorporated in any level 2 assembly with compatible overhangs, provided both Type IIS enzymes are included in the one-pot reaction cocktail.

https://doi.org/10.1371/journal.pone.0306008.g002

MultiGreen 2.0 takes inspiration from the other modular cloning standards that support multiplexing, such as GoldenBraid [ 7 ], Mobius Assembly [ 8 ], and MoClo [ 10 ] by parallelizing multiplexing with a suite of intermediary level 1 acceptor vectors. MultiGreen 2.0 assemblies are performed into a suite of level 1 acceptor vectors mirroring the overhang syntax of GreenGate assembly, allowing for concatenation of up to six level 1 assemblies in parallel. Alternation of antibiotic selection allows this to occur indefinitely with adequate planning of which level 1 acceptor vector complement to use, and strategic reversion to level 0 GreenGate entry vectors. Using the same assumptions as in MultiGreen 1.0 for assembly constraints, MultiGreen 2.0 assembly time scales at a rate of 2*⌈ log 6 n ⌉+3 days, where n is the number of transcriptional units. When comparing the time efficiency between MultiGreen 1.0 and 2.0, that is a time savings of nearly two weeks for a six transcriptional unit assembly, taking a minimum of 5 days with MultiGreen 2.0. By cloning with MultiGreen 2.0, the assembly is also better suited for future proofing, since transcriptional units can be more easily exchanged later.

The level 1 intermediary vectors of MultiGreen 2.0 use an additional pair of flanking Esp 3I sites to free assembled transcriptional units for additional rounds of assembly ( Fig 3 ). Each MultiGreen 2.0 level 1 acceptor vector contains a pair of Esp 3I sites externally flanking the Bsa I sites necessary for a GreenGate single transcriptional unit assembly. When a GreenGate reaction is performed using a MultiGreen 2.0 level 1 acceptor vector as the destination vector, it can then be digested with Esp 3I to liberate the assembled transcriptional unit for another GreenGate reaction, since Esp 3I digestion of MultiGreen 2.0 level 1 assemblies leaves behind either AB, BC, CD, DE, EF, or FG overhangs, depending on the MultiGreen level 1 intermediary destination vector chosen ( Fig 2 ). The freed overhangs enable level 1 assembly products to act as pseudo-level 0 modules.

A series of level 1 acceptor vectors are made with complimentary overhangs for each GreenGate entry module (AB, BC, CD, DE, EF, FG). A) The above example is for a MG2.0 AB assembly. A standard GreenGate cloning reaction is performed using the MG2.0 AB intermediary vector as denoted in A. The product of that assembly will hold the first gene cassette in the series. By the nature of the flanking Type IIS restriction enzyme sites, the recognition sequence for Bsa I is dropped out, but the 4bp overhangs are retained. This intermediary MG2.0 AB vector containing Gene cassette 1 can be used directly in a level 2 assembly incorporating Esp3I, be digested and used as an AB fragment in a subsequent GreenGate reaction or may be B) ligated into a GreenGate AB entry vector backbone effectively converting the level 1 assembly into a level 0 module.

https://doi.org/10.1371/journal.pone.0306008.g003

At its core, MultiGreen 2.0 enables recursive assembly of GreenGate modules. In other words, it enables performing GreenGate reactions into MultiGreen level 1 acceptor vectors, which when digested with Esp 3I, function as level 0 parts ( Fig 2 ). Should transcription blockers be a desirable feature between stacked gene cassettes, the dedicated FH transcription blocker module and HG filler module from MultiGreen 1.0 can be incorporated in each level 1 assembly, resulting in transcription blockers or other spacers being placed between cassettes. The HG filler module allows for GreenGate assembly with the additional H overhang when multiplexing in parallel.

In MultiGreen version 2.0, level 1 acceptor vectors are derived from the pVS1 backbone of pGGP-AG [ 14 ] for use as binary vectors directly in Agrobacterium , and each complement of level 1 intermediary vectors has a different antibiotic marker—either spectinomycin or kanamycin. Two antibiotic complements enable the cycling of level 1 assemblies. By alternating kanamycin and spectinomycin selection between reactions, undigested plasmid carryover from one assembly to the next is eliminated. Since Esp 3I digestion of level 1 MultiGreen 2.0 assemblies frees level 0-compatible overhangs, the individual transcriptional units released during Esp 3I digestion can also be readily converted back to true level 0 modules with T4 ligase. Should a level 0 reversion be desired for a particular assembly, it can be efficiently performed as outlined in S1 Method . A list of all plasmids in the MultiGreen kit and sequence maps can be found in Table 1 and S1 Dataset , respectively.

Includes all vectors for MultiGreen 1.0 cloning In series, MultiGreen 2.0 cloning in parallel, and adapters.

https://doi.org/10.1371/journal.pone.0306008.t001

MultiGreen 2.0 cloning validation in bacteria

As a proof of concept for MultiGreen 2.0 and to quantify the efficiency of a dual restriction-enzyme assembly, we reconstructed the partial violacein operon from Chromobacterium violaceum for production of protoviolaceinate in E . coli . C . violaceum is a species of gram-negative bacterium present various tropical and subtropical areas of the world [ 27 ]. A unique feature of the bacterium is that it produces the purple antimicrobial compound, violacein. Violacein is the end-product of a five-enzyme cascade beginning with L-tryptophan. Truncations of this operon result in visually distinct pigments [ 28 ]. Previously, Mobius assembly used protoviolaceinate as a functional validation of multiplexing, but only in validation of a level 1 reassembly of the polycistron [ 28 ].

The partial violacein operon from Chromobacterium violaceum was reassembled to produce protoviolaceinate via four independent transcriptional units using MultiGreen 2.0 ( Fig 4B ). To simplify the level 1 assemblies, level 0 modules were constructed with AC, CD, DF, FG overhangs representing the promoter, coding sequence, terminator, and filler sequence. Simplification of the modules was performed to avoid interruption of the gene products or distances between ribosome binding site, transcriptional start site, and start codon for each of the transcripts. Further, initial challenges with producing level 1 assemblies for vioA and vioD motivated the characterization of four promoter variants using a GFP expression assay ( S1 Fig ). Of the four promoter variants characterized, one (pGG-A-PJ23119::PGLPT-C/pVP217) highly expresses eGFP relative to that of a DH5α negative control, while the remaining three all express eGFP at low levels relative to that of the DH5α control ( S1 Fig ).

A) The full violacein operon and its product alongside two truncations producing different pigmented metabolites. B) Example Level 0 entry vectors for assembling the vioABDE operon using MultiGreen 2.0. Not pictured are the filler sequences to bridge overhang gaps (FG filler for level 1; FG eGFP cassette and CD filler for Level 2). Two different synthetic promoters and the bacteriophage T1 rrnB terminator were chosen to drive expression of the four genes from Chromobacterium violaceum to produce protoviolaceinate. C) A representative DH10B plate of the Level 2 assembly producing protoviolaceinate as noted by the dark colonies. D) Replicated colony counts of the assembly in independent one-pot reactions produced on different days.

https://doi.org/10.1371/journal.pone.0306008.g004

Overall efficiency of the parallelized MultiGreen 2.0 assembly for production of protoviolaceinate using both Esp 3I and Bsa I to concatenate level 1 modules was 95 ± 3% across three replicates ( Fig 1D ) as noted by the percentage of colonies expressing the pigment relative to the total of non-carryover colonies. Misassemblies that occurred appeared to consist of escapes resulting in vectors that lack the full vioABDE complement ( S3 Table ), potentially indicating a metabolic cost of vioABDE expression in E . coli in this fashion. Further, correctly assembled colonies required approximately 40 h for growth to reach a size comparable to that of an overnight E . coli colony without the vioABDE assembly.

In planta validation through deconstruction of the RUBY reporter

To further validate MultiGreen as a viable strategy to stack genes in one construct for plant transformation, we deconstructed the RUBY visual reporter [ 17 ] using MultiGreen 2.0. RUBY is a three-gene polycistronic transcript, encoding three separate peptides on one transcript. RUBY reconstitutes the biosynthetic pathway from Beta vulgaris that converts L-tyrosine into betanin. Each enzyme in the polycistron is separated by self-cleaving P2A peptides [ 17 ], using only one promoter and terminator to coordinate expression of all three genes simultaneously. Through a series of MultiGreen parallelized assemblies, we deconstructed the polycistronic transcript for independent transcript expression.

The individual transcriptional units of RUBY were combined with the Gm Ubi3L promoter and the StPinII terminator into spectinomycin-resistant MultiGreen 2.0 level 1 acceptor vectors. They were later concatenated with a linker module to produce the final reconstituted RUBY marker in a kanamycin-resistant pVS1-replicon destination vector ( Fig 5A ) and evaluated in Nicotiana benthamiana leaf infiltration ( Fig 5C ). The results of these infiltrations support MultiGreen 2.0 being an effective strategy to assemble multiplexed plasmids for in planta expression.

A) Workflow for infiltrating and extracting betanin pigments from Nicotiana benthamiana . 3–4 week old Nicotiana benthamiana cv. TW17 plants were infiltrated with Agrobacterium suspension at OD600 ranging from 0, 0.1, 0.2, 0.5, 1.0. Single leaf punches were removed from the infiltration sites. One punch per leaf, three leaves per plant, in three biological replicates performed on different days. Leaf discs were cleared of chlorophyll by soaking in 100% ethanol overnight. Betanin were bled out of the punches by transferring to a 96 well plate containing type I water prior to measuring absorbance at A538 on a Biotek Synergy 2 plate reader. B) Deconstructed RUBY plasmid made using MultiGreen 2.0 stacking the three transcripts of RUBY in tandem. C) Absorbance values for all leaf discs collected. Compact letter display of Tukey HSD comparisons across OD. microtube-open-translucent icon by Servier https://smart.servier.com/ is licensed under CC-BY 3.0 Unported https://creativecommons.org/licenses/by/3.0/ .

https://doi.org/10.1371/journal.pone.0306008.g005

MultiGreen expands the original GreenGate cloning architecture by enabling a rapid and efficient means of multiplexing. MultiGreen 1.0 and MultiGreen 2.0 enable multiplexing in series and parallel using components that strictly adhere to the architecture established in the original GreenGate kit. MultiGreen 1.0 takes inspiration from the original GreenGate approach to multiplexing in series, adding the optional H overhang through two new level 0 entry vectors. Alternating the multiplexer modules in MultiGreen 1.0 assemblies rapidly screens out carryover from one concatenation of level 0 modules to the next. Furthermore, MultiGreen 1.0 incorporates the ability to add transcription blockers or spacer sequences between transcriptional units to help minimize interference between successive gene cassettes.

MultiGreen 2.0 introduces multiplexing in parallel within the confines of the default GreenGate assembly architecture to further boost speed of assembly. Parallelized assembly also enables easier exchange of cassettes as needs for a particular gene stack change. In addition, by incorporating two complements of level 1 acceptor vectors for assembly with different antibiotic resistances, and reversion to level 0 modules, transcriptional units can be iteratively stacked in multiples of six. An infinite number of cassettes can therefore be stacked with MultiGreen, only limited by the carrying capacity of the host E . coli cloning strain.

The MultiGreen kit encompassing all the vectors and linkers presented in this report for cloning in series and in parallel are available through Addgene.

Supporting information

S1 method. supplementary methods..

https://doi.org/10.1371/journal.pone.0306008.s001

S1 Dataset. All plasmid sequences in the MultiGreen kit in GenBank format.

https://doi.org/10.1371/journal.pone.0306008.s002

S1 Fig. Evaluation of level 0 promoter modules in level 1 assemblies with eGFP.

A) Quantitative measurement of GFP on a Synergy2 microplate reader collected with a 485/20 nm excitation filter, 510 nm dichroic mirror, and a 516/20nm emission filter. B) Alignment of the four constructs. pVP272 contains the progenitor promoter module of pVP285; pVP284 contains the progenitor promoter module of pVP286. Level 0 promoter modules used in pVP284 and pVP286 remove out of frame ATG codons after the RBS, introducing Met-gly-ser residues within the A-C level 0 module itself.

https://doi.org/10.1371/journal.pone.0306008.s003

S1 Table. List of oligos used in this study.

https://doi.org/10.1371/journal.pone.0306008.s004

S2 Table. List of assemblies and level 0 components used in MultiGreen validation experiments.

https://doi.org/10.1371/journal.pone.0306008.s005

S3 Table. Misassemblies of the protoviolaceinate biosynthesis plasmid.

https://doi.org/10.1371/journal.pone.0306008.s006

• 1. Bolivar F, Backman K. [16] Plasmids of Escherichia coli as cloning vectors. Methods in enzymology. 68: Elsevier; 1979. p. 245–67.
• 2. Rogers SG, Klee H, Horsch R, Fraley R. [15] Improved vectors for plant transformation: Expression cassette vectors and new selectable markers. Methods in Enzymology. 153: Elsevier; 1987. p. 253–77.
• View Article
• PubMed/NCBI
• Google Scholar
• 6. Pryor JM, Potapov V, Pokhrel N, Lohman GJS. Rapid 40 kb genome construction from 52 parts. biorxivorg. 2020.
• 12. NEB. NEBuilder HiFi DNA Assembly Reaction Protocol New England Biolabs2014 [updated November 26, 2014]. https://www.neb.com/en-us/protocols/2014/11/26/nebuilder-hifi-dna-assembly-reaction-protocol .
• 13. NEB. NEBuilder HiFi DNA Assembly Transformation Protocol New England Biolabs2014 [updated November 26, 2014. https://www.neb.com/en-us/protocols/2014/11/26/nebuilder-hifi-dna-assembly-transformation-protocol .
• 16. NEB. Protocol for NEBridge ® Ligase Master Mix (NEB #M1100): New England Biolabs; 2021 [updated September 14, 2021.